Details

SpeciesHuman
Species subgroup
Subgroup typenone
Sequence NameIGLV3-16*01_t145g_t146c
IUIS Name
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic Only
MappedFalse
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start287
CDR1 End304
CDR2 Start356
CDR2 End364
CDR3 Start473

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGCCTGGATCCCTCTCCTGCTCCCCCTCCTCACTCTCTGCACAG
L-PART2 Start201
L-PART2 End211
L_PART2GCTCTGAGGCC
v_rs_start502
v_rs_end540
V_HEPTAMERCACAGTG
V_NONAMERACATAAACC

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02916
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2024-02-22
Release Notes

Supporting sequence and annotation updated

LocusIGL
Sequence TypeV
Gene Subgroup3
Gene Designation16
Allele Designation01_t145g_t146c

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample Gibson:HG02572

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-07-10 11:24:47
Version 1 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2024-02-22 15:37:24
Version 2 published

Supporting sequence and annotation updated

Changes from previous version

v1v2
Full Sequence
Gene start250212
Gene end539501
L-PART1 Start1
L-PART1 End46
L-PART2 Start239201
L-PART2 End249211
CDR1 Start325287
CDR1 End342304
CDR2 Start394356
CDR2 End402364
CDR3 Start511473
v_rs_start540502
v_rs_end578540

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGLV3-16*01_t145g_t146cGenomic Only1none12023-07-10
IGLV3-16*01_t145g_t146cGenomic Only1none22024-02-22