Species | Homo sapiens |
Species subgroup | |
Subgroup type | none |
Sequence Name | IGLV3-16*01_t145g_t146c |
IUIS Name | |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Unrearranged Only |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 287 |
CDR1 End | 304 |
CDR2 Start | 356 |
CDR2 End | 364 |
CDR3 Start | 473 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGGCCTGGATCCCTCTCCTGCTCCCCCTCCTCACTCTCTGCACAG |
L-PART2 Start | 201 |
L-PART2 End | 211 |
L_PART2 | GCTCTGAGGCC |
v_rs_start | 502 |
v_rs_end | 540 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACATAAACC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02916 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 2 |
Release Date | 2024-02-22 |
Release Notes | Supporting sequence and annotation updated |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 3 |
Gene Designation | 16 |
Allele Designation | 01_t145g_t146c |
Gene start | 212 |
Gene end | 501 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:47 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
William Lees 2024-02-22 15:37:24 | Version 2 published Supporting sequence and annotation updated |
v1 | v2 | |
---|---|---|
Full Sequence | ||
Gene start | 250 | 212 |
Gene end | 539 | 501 |
L-PART1 Start | 1 | |
L-PART1 End | 46 | |
L-PART2 Start | 239 | 201 |
L-PART2 End | 249 | 211 |
CDR1 Start | 325 | 287 |
CDR1 End | 342 | 304 |
CDR2 Start | 394 | 356 |
CDR2 End | 402 | 364 |
CDR3 Start | 511 | 473 |
v_rs_start | 540 | 502 |
v_rs_end | 578 | 540 |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGLV3-16*01_t145g_t146c | 1 | 2023-07-10 | |
IGLV3-16*01_t145g_t146c | 2 | 2024-02-22 |