Submission Details

Submission IDS00036
Submission Date2022-03-21 00:00:00
Submission Statusreviewing
SubmitterWilliam Lees
Submitter AddressBirkbeck College, University of London, Malet Street, London
SpeciesHuman_TCR
EthnicityUN

Inferred Sequences

The inferred novel alleles from each genotype that are submitted for review. This table lists all inferences put forward by the submitter. Where IARC has affirmed a sequence based on an inference, the corresponding sequence record will be listed in the Published column. Inferences for which no published sequence is shown have not been affirmed.

SequenceSubjectGenotypePublished
 TRBV12-1*01_C165ACI11P4_I11_S1_ogrdb_report
 TRBV12-2*01_T187CCI21P4_I16_S1_ogrdb_report
 TRBV20-1*02_319AGAGA323C10P4_I1_S1_ogrdb_report
 TRBV2*02_322GAAGC326C10P4_I1_S1_ogrdb_report
 TRBV12-5*01_C28G_T140ASC1P4_I21_S1_ogrdb_report
 TRBV6-6*01_G264ASC10P4_I22_S1_ogrdb_report
 TRBV6-9*01_A303GSC9P4_I31_S1_ogrdb_report
 TRBV15*02_G275AC7P4_I7_S1_ogrdb_report
 TRBV7-7*01_C315TC9P4_I9_S1_ogrdb_report
 TRBV5-6*01_T284GCI13P4_I12_S1_ogrdb_report
 TRBV12-4*01_C87TS24P4_I24_S1_ogrdb_report
 TRBV19*01_A24GS24P4_I24_S1_ogrdb_reportA02563

Genotypes

Each genotype that has been inferred, along with the descriptive name of the inference tool and settings that were used.

Genotype NameSubject IDLocusSequence TypeGenotype FilenameTool/Setting Name
 P4_I11_S1_ogrdb_reportCI11TRBVP4_I11_S1_ogrdb_report.csvP4_Sequence_protocol
 P4_I16_S1_ogrdb_reportCI21TRBVP4_I16_S1_ogrdb_report.csvP4_Sequence_protocol
 P4_I1_S1_ogrdb_reportC10TRBVP4_I1_S1_ogrdb_report.csvP4_Sequence_protocol
 P4_I21_S1_ogrdb_reportSC1TRBVP4_I21_S1_ogrdb_report.csvP4_Sequence_protocol
 P4_I22_S1_ogrdb_reportSC10TRBVP4_I22_S1_ogrdb_report.csvP4_Sequence_protocol
 P4_I31_S1_ogrdb_reportSC9TRBVP4_I31_S1_ogrdb_report.csvP4_Sequence_protocol
 P4_I7_S1_ogrdb_reportC7TRBVP4_I7_S1_ogrdb_report.csvP4_Sequence_protocol
 P4_I9_S1_ogrdb_reportC9TRBVP4_I9_S1_ogrdb_report.csvP4_Sequence_protocol
 P4_I12_S1_ogrdb_reportCI13TRBVP4_I12_S1_ogrdb_report.csvP4_Sequence_protocol
 P4_I24_S1_ogrdb_reportS24TRAVP4_I24_S1_ogrdb_report.csvP4_Sequence_protocol

Acknowledgements

Individuals who should be acknowledged as contributing to the inferences listed in this submission.

No Items

Repertoire Details

Details of the repertoire from which the inferences are based. This corresponds, for example, to an NIH Project or an ENA study.

RepositoryENA
Accession NumberPRJEB28370
Project/Study TitleAntibody repertoire analysis of Hepatitis C virus infections identifies immune signatures associated with spontaneous clearance
Dataset URLhttps://www.ebi.ac.uk/ena/browser/api/xml/PRJEB28370
MiAIRR Compliant?No
MiAIRR URL
Sequencing PlatformMiSeq 2x300
Read LengthFull
Primers Overlapping?Yes

Repertoire Publications

Publications associated with this study.

No Items

Sequences of the PCR primers used in the study.

Reverse primers

Primer NamePrimer Sequence
Hu-VH-NcoI-BACK1-1TTTAAGCCATGGCCCAGGTBCAGCTKGTRCARTCTGG
Hu-VH-NcoI-BACK1-2TTTAAGCCATGGCCCARATGCAGCTGGTGCAGTCTGG
Hu-VH-NcoI-BACK1-3TTTAAGCCATGGCCGARGTSCAGCTGGTRCAGTCTGG
Hu-VH-NcoI-BACK2-1TTTAAGCCATGGCCCAGATCACCTTGAAGGAGTCTGG
Hu-VH-NcoI-BACK2-2TTTAAGCCATGGCCCAGGTCACCTTGAGGGAGTCTGG
Hu-VH-NcoI-BACK2-3TTTAAGCCATGGCCCAGGTCACCTTGAAGGAGTCTGG
Hu-VH-NcoI-BACK3-1TTTAAGCCATGGCCGARGTRCARCTGGTGGAGTCYGG
Hu-VH-NcoI-BACK3-2TTTAAGCCATGGCCCAGGTGCAGCTGGTGGAGTCTGG
Hu-VH-NcoI-BACK3-3TTTAAGCCATGGCCGAGGTGCAGCTGTTGGAGTCTGG
Hu-VH-NcoI-BACK3-4TTTAAGCCATGGCCGAGGTGCAGCTGGTGGAGWCTG
Hu-VH-NcoI-BACK4-1TTTAAGCCATGGCCCAGGTGCARCTGCAGGAGTCGGG
Hu-VH-NcoI-BACK4-2TTTAAGCCATGGCCCAGCTGCAGCTGCAGGAGTCSGG
Hu-VH-NcoI-BACK6-1TTTAAGCCATGGCCCAGGTACAGCTGCAGCAGTCAGG

Forward primers

Primer NamePrimer Sequence
Hu-JH-FORF1-2-4-5TCCTGCTGAGCCTGAGGAGACRGTGACCAGGGTKCC
Hu-JH-FORF3TCCTGCTGAGCCTGAAGAGACGGTGACCATTGTCCC
Hu-JH-FORF6TCCTGCTGAGCCTGAGGAGACGGTGACCGTGGTCCC
Hu-JH-FORF1-2-4-5LCCACCACCACCGGATCCTCCTCCTCCTGCTGAGCCTGAGGAGACRGTGACCAGGGTKCC
Hu-JH-FORF3LCCACCACCACCGGATCCTCCTCCTCCTGCTGAGCCTGAAGAGACGGTGACCATTGTCCC
Hu-JH-FORF6LCCACCACCACCGGATCCTCCTCCTCCTGCTGAGCCTGAGGAGACGGTGACCGTGGTCCC

Inference Tools and Settings

Details of the inference tools and settings used to infer novel alleles. Each combination of tool and setting is listed here, and provided with a descriptive name.

Tool/Settings NameTool NameTool Version
 P4_Sequence_protocolTigGER1.0.0

Notes

TRBV12-1*01_c165a imported to OGRDB from VDJbase with the following notes:

TRBV12-2*01_t187c imported to OGRDB from VDJbase with the following notes:

TRBV20-1*02_319agaga323 imported to OGRDB from VDJbase with the following notes:

TRBV2*02_322gaagc326 imported to OGRDB from VDJbase with the following notes:

TRBV12-5*01_c28g_t140a imported to OGRDB from VDJbase with the following notes:

TRBV6-6*01_g264a imported to OGRDB from VDJbase with the following notes:

TRBV6-9*01_a303g imported to OGRDB from VDJbase with the following notes:

TRBV15*02_g275a imported to OGRDB from VDJbase with the following notes:

TRBV7-7*01_c315t imported to OGRDB from VDJbase with the following notes:

Attachment File Name
 P4_I1_S1_ogrdb_plots.pdf
 P4_I7_S1_ogrdb_plots.pdf
 P4_I9_S1_ogrdb_plots.pdf
 P4_I11_S1_ogrdb_plots.pdf
 P4_I12_S1_ogrdb_plots.pdf
 P4_I16_S1_ogrdb_plots.pdf
 P4_I21_S1_ogrdb_plots.pdf
 P4_I22_S1_ogrdb_plots.pdf
 P4_I24_S1_ogrdb_plots.pdf
 P4_I31_S1_ogrdb_plots.pdf