Submission S00036 (William Lees)
Submission Details
| Submission ID | S00036 |
| Submission Date | 2022-03-21 00:00:00 |
| Submission Status | reviewing |
| Submitter | William Lees |
| Submitter Address | Birkbeck College, University of London, Malet Street, London |
| Species | Homo sapiens |
| Ethnicity | UN |
Inferred Sequences
The inferred novel alleles from each genotype that are submitted for review. This table lists all inferences put forward by the submitter. Where IARC has affirmed a sequence based on an inference, the corresponding sequence record will be listed in the Published column. Inferences for which no published sequence is shown have not been affirmed.
| Sequence | Subject | Genotype | Published | |
|---|---|---|---|---|
| TRBV12-1*01_C165A | CI11 | P4_I11_S1_ogrdb_report | ||
| TRBV12-2*01_T187C | CI21 | P4_I16_S1_ogrdb_report | ||
| TRBV20-1*02_319AGAGA323 | C10 | P4_I1_S1_ogrdb_report | ||
| TRBV2*02_322GAAGC326 | C10 | P4_I1_S1_ogrdb_report | ||
| TRBV12-5*01_C28G_T140A | SC1 | P4_I21_S1_ogrdb_report | A03002 | |
| TRBV6-6*01_G264A | SC10 | P4_I22_S1_ogrdb_report | ||
| TRBV6-9*01_A303G | SC9 | P4_I31_S1_ogrdb_report | ||
| TRBV15*02_G275A | C7 | P4_I7_S1_ogrdb_report | ||
| TRBV7-7*01_C315T | C9 | P4_I9_S1_ogrdb_report | A02570 | |
| TRBV5-6*01_T284G | CI13 | P4_I12_S1_ogrdb_report | A02568 | |
| TRBV12-4*01_C87T | S24 | P4_I24_S1_ogrdb_report | A02565 | |
| TRBV19*01_A24G | S24 | P4_I24_S1_ogrdb_report | A02563 |
Genotypes
Each genotype that has been inferred, along with the descriptive name of the inference tool and settings that were used.
Acknowledgements
Individuals who should be acknowledged as contributing to the inferences listed in this submission.
No Items
Repertoire Details
Details of the repertoire from which the inferences are based. This corresponds, for example, to an NIH Project or an ENA study.
| Repository | ENA |
| Accession Number | PRJEB28370 |
| Project/Study Title | Antibody repertoire analysis of Hepatitis C virus infections identifies immune signatures associated with spontaneous clearance |
| Dataset URL | https://www.ebi.ac.uk/ena/browser/api/xml/PRJEB28370 |
| MiAIRR Compliant? | No |
| MiAIRR URL | |
| Sequencing Platform | MiSeq 2x300 |
| Read Length | Full |
| Primers Overlapping? | No |
Repertoire Publications
Publications associated with this study.
| PubMed ID | Title | Authors |
|---|---|---|
| 30622532 | Antibody Repertoire Analysis of Hepatitis C Virus Infections Identifies Immune Signatures Associated With Spontaneous Clearance. | Eliyahu S, Sharabi O, Elmedvi S, Timor R, Davidovich A, Vigneault F, Clouser C, Hope R, Nimer A, Braun M, Weiss YY, Polak P, Yaari G, Gal-Tanamy M |
PCR Primers
Sequences of the PCR primers used in the study.
Constant region primers
| Primer Name | Primer Sequence |
|---|---|
| TRA1_R1 | CACGGCAGGGTCAGGGTTC |
| TRB1_R1 | CGACCTCGGGTGGGAACAC |
| TRD1_R1 | ACCAGACAAGCGACATTTGTTCC |
| TRG1_R1 | GGGGAAACATCTGCATCAAGTTG |
Notes
TRBV12-1*01_c165a imported to OGRDB from VDJbase with the following notes:
TRBV12-2*01_t187c imported to OGRDB from VDJbase with the following notes:
TRBV20-1*02_319agaga323 imported to OGRDB from VDJbase with the following notes:
TRBV2*02_322gaagc326 imported to OGRDB from VDJbase with the following notes:
TRBV12-5*01_c28g_t140a imported to OGRDB from VDJbase with the following notes:
TRBV6-6*01_g264a imported to OGRDB from VDJbase with the following notes:
TRBV6-9*01_a303g imported to OGRDB from VDJbase with the following notes:
TRBV15*02_g275a imported to OGRDB from VDJbase with the following notes:
TRBV7-7*01_c315t imported to OGRDB from VDJbase with the following notes: