Submission ID | S00036 |
Submission Date | 2022-03-21 00:00:00 |
Submission Status | reviewing |
Submitter | William Lees |
Submitter Address | Birkbeck College, University of London, Malet Street, London |
Species | Human_TCR |
Ethnicity | UN |
The inferred novel alleles from each genotype that are submitted for review. This table lists all inferences put forward by the submitter. Where IARC has affirmed a sequence based on an inference, the corresponding sequence record will be listed in the Published column. Inferences for which no published sequence is shown have not been affirmed.
Sequence | Subject | Genotype | Published | |
---|---|---|---|---|
TRBV12-1*01_C165A | CI11 | P4_I11_S1_ogrdb_report | ||
TRBV12-2*01_T187C | CI21 | P4_I16_S1_ogrdb_report | ||
TRBV20-1*02_319AGAGA323 | C10 | P4_I1_S1_ogrdb_report | ||
TRBV2*02_322GAAGC326 | C10 | P4_I1_S1_ogrdb_report | ||
TRBV12-5*01_C28G_T140A | SC1 | P4_I21_S1_ogrdb_report | ||
TRBV6-6*01_G264A | SC10 | P4_I22_S1_ogrdb_report | ||
TRBV6-9*01_A303G | SC9 | P4_I31_S1_ogrdb_report | ||
TRBV15*02_G275A | C7 | P4_I7_S1_ogrdb_report | ||
TRBV7-7*01_C315T | C9 | P4_I9_S1_ogrdb_report | ||
TRBV5-6*01_T284G | CI13 | P4_I12_S1_ogrdb_report | A02568 | |
TRBV12-4*01_C87T | S24 | P4_I24_S1_ogrdb_report | A02565 | |
TRBV19*01_A24G | S24 | P4_I24_S1_ogrdb_report | A02563 |
Each genotype that has been inferred, along with the descriptive name of the inference tool and settings that were used.
Individuals who should be acknowledged as contributing to the inferences listed in this submission.
Details of the repertoire from which the inferences are based. This corresponds, for example, to an NIH Project or an ENA study.
Repository | ENA |
Accession Number | PRJEB28370 |
Project/Study Title | Antibody repertoire analysis of Hepatitis C virus infections identifies immune signatures associated with spontaneous clearance |
Dataset URL | https://www.ebi.ac.uk/ena/browser/api/xml/PRJEB28370 |
MiAIRR Compliant? | No |
MiAIRR URL | |
Sequencing Platform | MiSeq 2x300 |
Read Length | Full |
Primers Overlapping? | No |
Publications associated with this study.
PubMed ID | Title | Authors |
---|---|---|
30622532 | Antibody Repertoire Analysis of Hepatitis C Virus Infections Identifies Immune Signatures Associated With Spontaneous Clearance. | Eliyahu S, Sharabi O, Elmedvi S, Timor R, Davidovich A, Vigneault F, Clouser C, Hope R, Nimer A, Braun M, Weiss YY, Polak P, Yaari G, Gal-Tanamy M |
Sequences of the PCR primers used in the study.
Primer Name | Primer Sequence |
---|---|
TRA1_R1 | CACGGCAGGGTCAGGGTTC |
TRB1_R1 | CGACCTCGGGTGGGAACAC |
TRD1_R1 | ACCAGACAAGCGACATTTGTTCC |
TRG1_R1 | GGGGAAACATCTGCATCAAGTTG |
Details of the inference tools and settings used to infer novel alleles. Each combination of tool and setting is listed here, and provided with a descriptive name.
Tool/Settings Name | Tool Name | Tool Version | |
---|---|---|---|
P4_Sequence_protocol | TigGER | 1.0.0 |
TRBV12-1*01_c165a imported to OGRDB from VDJbase with the following notes:
TRBV12-2*01_t187c imported to OGRDB from VDJbase with the following notes:
TRBV20-1*02_319agaga323 imported to OGRDB from VDJbase with the following notes:
TRBV2*02_322gaagc326 imported to OGRDB from VDJbase with the following notes:
TRBV12-5*01_c28g_t140a imported to OGRDB from VDJbase with the following notes:
TRBV6-6*01_g264a imported to OGRDB from VDJbase with the following notes:
TRBV6-9*01_a303g imported to OGRDB from VDJbase with the following notes:
TRBV15*02_g275a imported to OGRDB from VDJbase with the following notes:
TRBV7-7*01_c315t imported to OGRDB from VDJbase with the following notes: