| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGHV1-3*04 |
| IUIS Name | IGHV1-3*04 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged and rearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| MH779622 | Inferred | GenBank | 1 | 295 | ||
| SRX19354902 | V | Genbank | 1 | 477 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 218 |
| CDR1 End | 241 |
| CDR2 Start | 293 |
| CDR2 End | 316 |
| CDR3 Start | 431 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGACTGGACCTGGAGGATCCTCTTTTTGGTGGCAGCAGCCACAG |
| L-PART2 Start | 132 |
| L-PART2 End | 142 |
| L_PART2 | GTGCCCACTCC |
| v_rs_start | 439 |
| v_rs_end | 477 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | TCAGAAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A00007 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 7 |
| Release Date | 2026-05-27 |
| Release Notes | Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 1 |
| Gene Designation | 3 |
| Allele Designation | 04 |
| Gene start | 143 |
| Gene end | 438 |
Notes are added by IARC reviewers.
| Originally approved by IARC on March 9, 2018. “The sequence was inferred [..] using IgDiscover, and [..] using both Partis and TIgGER. The number of unique CDR3 used by sequences with exact matches to the inferred germline allele represents 1.3% of all unique CDR3 [unmutated frequency: 1.17%] associated to exact IGHV matches in the genotype, according to IgDiscover. There were at least 775 unique rearrangements, utilizing 22 D genes and 7 J genes. The allele was the more frequently utilized allele, with an expression ratio of 56:44 with the *01 allele. The inference was supported by haplotype analysis using IGHJ6*02/*03.” (April 12, 2019) A trailing “.” in the sequence indicates IARC’s opinion that the sequence is likely to contain additional 3’ nucleotides for which there is insufficient evidence to make an affirmation. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| Mats Ohlin 2018-12-21 12:09:07 | Version 1 published Submission published by IARC on Dec 21, 2018. |
| Mats Ohlin 2019-04-12 14:30:09 | Version 2 published Version 2 published |
| Mats Ohlin 2019-04-12 14:31:16 | Version 3 published In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 319. A trailing “.” indicates IARC’s opinion that the sequences likely to contain an additional/additional 3’ nucleotide(s) for which there is insufficient evidence to make an affirmation. |
| Mats Ohlin 2019-04-12 14:52:06 | Version 4 published A trailing “.” in the sequence indicates IARC’s opinion that the sequence is likely to contain additional 3’ nucleotides for which there is insufficient evidence to make an affirmation. |
| Mats Ohlin 2019-05-16 21:46:24 | Version 5 published Updated with infomation of the IMGT gene name |
| William Lees 2023-07-10 11:24:35 | Version 6 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2026-05-27 07:52:07 | Version 7 published Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| v6 | v7 | |
|---|---|---|
| Curator address | Birkbeck College, University of London, Malet Street, London | Clareo Biosciences, Louisville, Kentucky, USA |
| Alternative names | IGHV1-3*i01 | |
| Mapped | False | True |
| Inference Type | Rearranged Only | Unrearranged and rearranged |
| Full Sequence | ||
| Coding Sequence | ||
| Gene start | 1 | 143 |
| Gene end | 295 | 438 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 132 | |
| L-PART2 End | 142 | |
| CDR1 Start | 76 | 218 |
| CDR1 End | 99 | 241 |
| CDR2 Start | 151 | 293 |
| CDR2 End | 174 | 316 |
| CDR3 Start | 289 | 431 |
| v_rs_start | 439 | |
| v_rs_end | 477 | |
| Extension? | True | False |
| 3' Extension | A | |
| curational_tags | likely_truncated | likely_full_length |
| Notes | changed |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGHV1-3*i01 | 1 | 2018-12-21 | |
| IGHV1-3*i01 | 2 | 2019-04-12 | |
| IGHV1-3*i01 | 3 | 2019-04-12 | |
| IGHV1-3*i01 | 4 | 2019-04-12 | |
| IGHV1-3*i01 | IGHV1-3*04 | 5 | 2019-05-16 |
| IGHV1-3*04 | IGHV1-3*04 | 6 | 2023-07-10 |
| IGHV1-3*04 | IGHV1-3*04 | 7 | 2026-05-27 |