| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGHV4-30-4*08 |
| IUIS Name | IGHV4-30-4*08 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged and rearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| MH779624 | Inferred | GenBank | 1 | 298 | ||
| SRX19354824 | V | Genbank | 1 | 477 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 215 |
| CDR1 End | 244 |
| CDR2 Start | 296 |
| CDR2 End | 316 |
| CDR3 Start | 431 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGAT |
| L-PART2 Start | 129 |
| L-PART2 End | 139 |
| L_PART2 | GGGTCCTGTCC |
| v_rs_start | 439 |
| v_rs_end | 477 |
| V_HEPTAMER | CACAATG |
| V_NONAMER | ACACAAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A00009 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 6 |
| Release Date | 2026-05-27 |
| Release Notes | Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 4 |
| Gene Designation | 30-4 |
| Allele Designation | 08 |
| Gene start | 140 |
| Gene end | 438 |
Notes are added by IARC reviewers.
| Originally approved by IARC on April 13, 2018. “The sequence is present at high frequency (1.3%), in the IgDiscover analysis. It was inferred by IgDiscover, TIger and Partis. Haplotype analysis was supportive of the inference, as the sequence was strongly associated with the IGHJ6*03 haplotype. The sequence has previously been reported from genomic sequencing, and by inference from VDJ data, and is documented in IgPdb as IGHV4-30-4*p08. It was agreed that the sequence should be moved to Level 1.” In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 319. (April 12, 2019) A trailing “.” in the sequence indicates IARC’s opinion that the sequence is likely to contain additional 3’ nucleotides for which there is insufficient evidence to make an affirmation. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| Mats Ohlin 2018-12-21 12:11:12 | Version 1 published Submission published by IARC on Dec 21, 2018. |
| Andrew Collins 2019-04-03 04:21:41 | Version 2 published This version was created to include details highlighting the fact that the published sequence was affirmed up to and including nucleotide 319, but the submitted sequence was one nucleotide longer. |
| Mats Ohlin 2019-04-12 14:51:13 | Version 3 published A trailing “.” in the sequence indicates IARC’s opinion that the sequence is likely to contain additional 3’ nucleotides for which there is insufficient evidence to make an affirmation. |
| Mats Ohlin 2019-05-16 21:50:41 | Version 4 published IMGT allele name added |
| William Lees 2023-07-10 11:24:40 | Version 5 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2026-05-27 07:52:09 | Version 6 published Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| v5 | v6 | |
|---|---|---|
| Curator address | Birkbeck College, University of London, Malet Street, London | Clareo Biosciences, Louisville, Kentucky, USA |
| Alternative names | IGHV4-30-4*i01 | |
| Mapped | False | True |
| Inference Type | Rearranged Only | Unrearranged and rearranged |
| Full Sequence | ||
| Coding Sequence | ||
| Gene start | 1 | 140 |
| Gene end | 298 | 438 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 129 | |
| L-PART2 End | 139 | |
| CDR1 Start | 76 | 215 |
| CDR1 End | 105 | 244 |
| CDR2 Start | 157 | 296 |
| CDR2 End | 177 | 316 |
| CDR3 Start | 292 | 431 |
| v_rs_start | 439 | |
| v_rs_end | 477 | |
| Extension? | True | False |
| 3' Extension | A | |
| curational_tags | likely_truncated | likely_full_length |
| Notes | changed |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGHV4-30-4*i01 | 1 | 2018-12-21 | |
| IGHV4-30-4*i01 | 2 | 2019-04-03 | |
| IGHV4-30-4*i01 | 3 | 2019-04-12 | |
| IGHV4-30-4*i01 | IGHV4-30-4*08 | 4 | 2019-05-16 |
| IGHV4-30-4*08 | IGHV4-30-4*08 | 5 | 2023-07-10 |
| IGHV4-30-4*08 | IGHV4-30-4*08 | 6 | 2026-05-27 |