Details

SpeciesHomo sapiens
Species subgroup
Subgroup type
Sequence NameIGHV4-30-4*08
IUIS NameIGHV4-30-4*08
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeUnrearranged and rearranged
MappedTrue
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEndCoding SequenceSC Coding Sequence
MH779624InferredGenBank1298
SRX19354824VGenbank1477

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start215
CDR1 End244
CDR2 Start296
CDR2 End316
CDR3 Start431

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGAT
L-PART2 Start129
L-PART2 End139
L_PART2GGGTCCTGTCC
v_rs_start439
v_rs_end477
V_HEPTAMERCACAATG
V_NONAMERACACAAACC
Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA00009
CuratorWilliam Lees
Curator addressClareo Biosciences, Louisville, Kentucky, USA
Version6
Release Date2026-05-27
Release Notes

Repeat – had to roll back yesterday’s changes.

Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names

LocusIGH
Sequence TypeV
Gene Subgroup4-30
Gene Designation4
Allele Designation08
Gene start140
Gene end438

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Originally approved by IARC on April 13, 2018.

“The sequence is present at high frequency (1.3%), in the IgDiscover analysis. It was inferred by IgDiscover, TIger and Partis. Haplotype analysis was supportive of the inference, as the sequence was strongly associated with the IGHJ6*03 haplotype. The sequence has previously been reported from genomic sequencing, and by inference from VDJ data, and is documented in IgPdb as IGHV4-30-4*p08. It was agreed that the sequence should be moved to Level 1.”

In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 319.

(April 12, 2019) A trailing “.” in the sequence indicates IARC’s opinion that the sequence is likely to contain additional 3’ nucleotides for which there is insufficient evidence to make an affirmation.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample MH779624
VDJbase example haplotype: P1_I64

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Annotation is based on VDJbase record P25_I129_S1 for sample W-64 (Genbank: SRX19354824).

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2018-12-21 12:11:12
Version 1 published

Submission published by IARC on Dec 21, 2018.

Andrew Collins
2019-04-03 04:21:41
Version 2 published

This version was created to include details highlighting the fact that the published sequence was affirmed up to and including nucleotide 319, but the submitted sequence was one nucleotide longer.

Mats Ohlin
2019-04-12 14:51:13
Version 3 published

A trailing “.” in the sequence indicates IARC’s opinion that the sequence is likely to contain additional 3’ nucleotides for which there is insufficient evidence to make an affirmation.

Mats Ohlin
2019-05-16 21:50:41
Version 4 published

IMGT allele name added

William Lees
2023-07-10 11:24:40
Version 5 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2026-05-27 07:52:09
Version 6 published

Repeat – had to roll back yesterday’s changes.

Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names

Changes from previous version

v5v6
Curator addressBirkbeck College, University of London, Malet Street, LondonClareo Biosciences, Louisville, Kentucky, USA
Alternative namesIGHV4-30-4*i01
MappedFalseTrue
Inference TypeRearranged OnlyUnrearranged and rearranged
Full Sequence
Coding Sequence
Gene start1140
Gene end298438
L-PART1 Start1
L-PART1 End46
L-PART2 Start129
L-PART2 End139
CDR1 Start76215
CDR1 End105244
CDR2 Start157296
CDR2 End177316
CDR3 Start292431
v_rs_start439
v_rs_end477
Extension?TrueFalse
3' ExtensionA
curational_tagslikely_truncatedlikely_full_length
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIMGT NameVersionDate
IGHV4-30-4*i0112018-12-21
IGHV4-30-4*i0122019-04-03
IGHV4-30-4*i0132019-04-12
IGHV4-30-4*i01IGHV4-30-4*0842019-05-16
IGHV4-30-4*08IGHV4-30-4*0852023-07-10
IGHV4-30-4*08IGHV4-30-4*0862026-05-27