| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGHV3-43D*04 |
| IUIS Name | IGHV3-43D*04 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged and rearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| BK010573 | Inferred | GenBank | 1 | 297 | ||
| SRX19354892 | V | Genbank | 1 | 497 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 236 |
| CDR1 End | 259 |
| CDR2 Start | 311 |
| CDR2 End | 334 |
| CDR3 Start | 449 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGAGTTTGGACTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAG |
| L-PART2 Start | 150 |
| L-PART2 End | 160 |
| L_PART2 | GTGTCCAGTGT |
| v_rs_start | 459 |
| v_rs_end | 497 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACAAAAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A00005 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 4 |
| Release Date | 2026-05-27 |
| Release Notes | Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 3 |
| Gene Designation | 43D |
| Allele Designation | 04 |
| Gene start | 161 |
| Gene end | 458 |
Notes are added by IARC reviewers.
| Originally approved by IARC on May 11, 2018. “The sequence is present at low frequency (0.07%), in the IgDiscover analysis. It was inferred by IgDiscover. No information was provided by the submitter regarding analysis with partis or TIgGER. Haplotype analysis could not be performed. Analysis for chimerism did not provide evidence against the existence of the sequence. It was agreed that the sequence should be moved to Level 1, subject to the provision of additional information.” Further deliberation on May 25, 2018 The allele was incorporated into IMGT on October 4, 2018 as IGHV3-43D*04. (April 12, 2019) In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 321. A trailing “.” indicates IARC’s opinion that the sequences likely to contain an additional/additional 3’ nucleotide(s) for which there is insufficient evidence to make an affirmation. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| Mats Ohlin 2018-12-21 12:10:41 | Version 1 published Submission published by IARC on Dec 21, 2018. |
| Mats Ohlin 2019-04-12 14:33:49 | Version 2 published In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 321. A trailing “.” indicates IARC’s opinion that the sequences likely to contain an additional/additional 3’ nucleotide(s) for which there is insufficient evidence to make an affirmation. |
| William Lees 2023-07-10 11:24:39 | Version 3 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2026-05-27 07:52:07 | Version 4 published Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| v3 | v4 | |
|---|---|---|
| Curator address | Birkbeck College, University of London, Malet Street, London | Clareo Biosciences, Louisville, Kentucky, USA |
| Alternative names | IGHV3-43D*i01 | |
| Mapped | False | True |
| Inference Type | Rearranged Only | Unrearranged and rearranged |
| Full Sequence | ||
| Coding Sequence | ||
| Gene start | 1 | 161 |
| Gene end | 297 | 458 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 150 | |
| L-PART2 End | 160 | |
| CDR1 Start | 76 | 236 |
| CDR1 End | 99 | 259 |
| CDR2 Start | 151 | 311 |
| CDR2 End | 174 | 334 |
| CDR3 Start | 289 | 449 |
| v_rs_start | 459 | |
| v_rs_end | 497 | |
| Extension? | True | False |
| 3' Extension | A | |
| curational_tags | likely_truncated | likely_full_length |
| Notes | changed |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGHV3-43D*i01 | IGHV3-43D*04 | 1 | 2018-12-21 |
| IGHV3-43D*i01 | IGHV3-43D*04 | 2 | 2019-04-12 |
| IGHV3-43D*04 | IGHV3-43D*04 | 3 | 2023-07-10 |
| IGHV3-43D*04 | IGHV3-43D*04 | 4 | 2026-05-27 |