Details

SpeciesHomo sapiens
Species subgroup
Subgroup type
Sequence NameIGHV3-43D*04
IUIS NameIGHV3-43D*04
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeUnrearranged and rearranged
MappedTrue
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEndCoding SequenceSC Coding Sequence
BK010573InferredGenBank1297
SRX19354892VGenbank1497

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start236
CDR1 End259
CDR2 Start311
CDR2 End334
CDR3 Start449

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGAGTTTGGACTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAG
L-PART2 Start150
L-PART2 End160
L_PART2GTGTCCAGTGT
v_rs_start459
v_rs_end497
V_HEPTAMERCACAGTG
V_NONAMERACAAAAACC
Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA00005
CuratorWilliam Lees
Curator addressClareo Biosciences, Louisville, Kentucky, USA
Version4
Release Date2026-05-27
Release Notes

Repeat – had to roll back yesterday’s changes.

Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names

LocusIGH
Sequence TypeV
Gene Subgroup3
Gene Designation43D
Allele Designation04
Gene start161
Gene end458

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Originally approved by IARC on May 11, 2018.

“The sequence is present at low frequency (0.07%), in the IgDiscover analysis. It was inferred by IgDiscover. No information was provided by the submitter regarding analysis with partis or TIgGER. Haplotype analysis could not be performed. Analysis for chimerism did not provide evidence against the existence of the sequence. It was agreed that the sequence should be moved to Level 1, subject to the provision of additional information.”

Further deliberation on May 25, 2018
“MO provided information regarding primers used to generate the data upon which the submission of Linnea Thornquist was based. It was agreed that the information was sufficient for the previous decisions of IARC to be ratified (see minutes Meeting 14).”

The allele was incorporated into IMGT on October 4, 2018 as IGHV3-43D*04.
The other most similar allele IGHV3-43D*01 has since this inference was performed been renamed by IMGT as IGHV3-43D*03.

(April 12, 2019) In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 321. A trailing “.” indicates IARC’s opinion that the sequences likely to contain an additional/additional 3’ nucleotide(s) for which there is insufficient evidence to make an affirmation.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample BK010573
VDJbase example haplotype: P1_I23

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Annotation is based on VDJbase record P25_I98_S1 for sample W-19 (Genbank: SRX19354892).

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2018-12-21 12:10:41
Version 1 published

Submission published by IARC on Dec 21, 2018.

Mats Ohlin
2019-04-12 14:33:49
Version 2 published

In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 321. A trailing “.” indicates IARC’s opinion that the sequences likely to contain an additional/additional 3’ nucleotide(s) for which there is insufficient evidence to make an affirmation.

William Lees
2023-07-10 11:24:39
Version 3 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2026-05-27 07:52:07
Version 4 published

Repeat – had to roll back yesterday’s changes.

Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names

Changes from previous version

v3v4
Curator addressBirkbeck College, University of London, Malet Street, LondonClareo Biosciences, Louisville, Kentucky, USA
Alternative namesIGHV3-43D*i01
MappedFalseTrue
Inference TypeRearranged OnlyUnrearranged and rearranged
Full Sequence
Coding Sequence
Gene start1161
Gene end297458
L-PART1 Start1
L-PART1 End46
L-PART2 Start150
L-PART2 End160
CDR1 Start76236
CDR1 End99259
CDR2 Start151311
CDR2 End174334
CDR3 Start289449
v_rs_start459
v_rs_end497
Extension?TrueFalse
3' ExtensionA
curational_tagslikely_truncatedlikely_full_length
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIMGT NameVersionDate
IGHV3-43D*i01IGHV3-43D*0412018-12-21
IGHV3-43D*i01IGHV3-43D*0422019-04-12
IGHV3-43D*04IGHV3-43D*0432023-07-10
IGHV3-43D*04IGHV3-43D*0442026-05-27