Details

SpeciesHomo sapiens
Species subgroup
Subgroup type
Sequence NameIGHV2-70*20
IUIS NameIGHV2-70*20
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeUnrearranged and rearranged
MappedTrue
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEndCoding SequenceSC Coding Sequence
MK471379InferredGenBank1298
SRX19354902VGenbank1483

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start219
CDR1 End248
CDR2 Start300
CDR2 End320
CDR3 Start435

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGACATACTTTGTTCCACGCTCCTGCTACTGACTGTCCCGTCCT
L-PART2 Start133
L-PART2 End143
L_PART2GGGTCTTATCC
v_rs_start445
v_rs_end483
V_HEPTAMERCACAGAG
V_NONAMERACAAGAACC
Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA00044
CuratorWilliam Lees
Curator addressClareo Biosciences, Louisville, Kentucky, USA
Version3
Release Date2026-05-27
Release Notes

Repeat – had to roll back yesterday’s changes.

Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names

LocusIGH
Sequence TypeV
Gene Subgroup2
Gene Designation70
Allele Designation20
Gene start144
Gene end444

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Assessed by IARC on November 18, 2019 during meeting 45.

The committee considered IGHV2-70*01_S6619 (A124G) of Genotype B12 of submission S00010, which was previously evaluated as IGHV2-70*01_S4660 of submission S00004 at Meeting 8. It was affirmed as a Level 0 sequence at that time.

The sequence was seen in just 0.05% of all unmutated rearrangements, with 296 sequences including 93 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. Two other alleles were present in the genotype, and it is possible that one of these three sequences is an IGHV2-70D sequence. Haplotype data is supportive of the inference, but in light of the very low frequency of rearrangements seen and the complicated haplotype of this subject, it was affirmed as a Level 0 sequence. The sequence was affirmed up to and including nucleotide 319 even though alleles of IGHV2-70/IGHV2-70D in general extend up to and including base 322. However, the nucleotide composition of the subsequent three bases of genes associated with this inferred allele did not support their inference. It is however likely that three additional 3’ nucleotides are present in the sequence, and this is indicated in IARC and OGRDB publications by three dots at the end of the sequence.

At the IARC Meeting 68, April 26th 2021, it was agreed that sequences affirmed by the IARC as Level 0 sequences, that subsequently have entered the IMGT germline gene database by other means, should be elevated to Level 1.

At the IARC Meeting 69, May 18th 2021, IGHV2-70*i01 was elevated to Level 1. This sequence was incorporated into the IMGT germline gene database as a consequence of the IMGT-NC Report #2020-2-1008 (October 8th, 2020). The sequence was submitted to IMGT by Abdullah Gamal Dorgham, William Sinclair Gibson, Oscar Rodriguez and Corey Watson. The sequence recorded in OGRDB remains the sequence that was affirmed as the original IGHV2-70*i01 sequence. The sequence that is now recognized as IGHV2-70*20 includes the final three nucleotides of the sequence – TAC.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample MK471379
Mapped by IARC haplotype

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Annotation is based on VDJbase record P25_I107_S1 for sample W-34 (Genbank: SRX19354902).

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Andrew Collins
2019-12-12 22:50:56
Version 1 published

Submission published by IARC on Dec 13, 2019.

Andrew Collins
2021-05-18 13:27:45
Version 2 published

IGHV2-70*i01 was elevated to Level 1 on May 18th 2021 at IARC Meeting 69, in recognition of the entry of this sequence into the IMGT germline gene database, as a result of submission of the sequence to IMGT by processes external to the IARC.

Mats Ohlin
2021-05-18 23:41:47
IMGT Name updated to IGHV2-70*20

IMGT Name updated.

Mats Ohlin
2021-05-18 23:41:53
IMGT Name updated to IGHV2-70*20

IMGT Name updated.

William Lees
2023-07-10 11:24:36
Version 2 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2026-05-27 07:52:08
Version 3 published

Repeat – had to roll back yesterday’s changes.

Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names

Changes from previous version

v2v3
Curator addressBirkbeck College, University of London, Malet Street, LondonClareo Biosciences, Louisville, Kentucky, USA
Alternative namesIGHV2-70*i01
Inference TypeRearranged OnlyUnrearranged and rearranged
Full Sequence
Coding Sequence
Gene start1144
Gene end298444
L-PART1 Start1
L-PART1 End46
L-PART2 Start133
L-PART2 End143
CDR1 Start76219
CDR1 End105248
CDR2 Start157300
CDR2 End177320
CDR3 Start292435
v_rs_start445
v_rs_end483
Extension?TrueFalse
3' ExtensionTAC
curational_tagslikely_truncatedlikely_full_length
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIUIS NameVersionDate
IGHV2-70*i0112019-12-12
IGHV2-70*i01IGHV2-70*2012021-05-18
IGHV2-70*20IGHV2-70*2022023-07-10
IGHV2-70*20IGHV2-70*2032026-05-27