| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGHV2-70*20 |
| IUIS Name | IGHV2-70*20 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged and rearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| MK471379 | Inferred | GenBank | 1 | 298 | ||
| SRX19354902 | V | Genbank | 1 | 483 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 219 |
| CDR1 End | 248 |
| CDR2 Start | 300 |
| CDR2 End | 320 |
| CDR3 Start | 435 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGACATACTTTGTTCCACGCTCCTGCTACTGACTGTCCCGTCCT |
| L-PART2 Start | 133 |
| L-PART2 End | 143 |
| L_PART2 | GGGTCTTATCC |
| v_rs_start | 445 |
| v_rs_end | 483 |
| V_HEPTAMER | CACAGAG |
| V_NONAMER | ACAAGAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A00044 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 3 |
| Release Date | 2026-05-27 |
| Release Notes | Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 2 |
| Gene Designation | 70 |
| Allele Designation | 20 |
| Gene start | 144 |
| Gene end | 444 |
Notes are added by IARC reviewers.
| Assessed by IARC on November 18, 2019 during meeting 45. The committee considered IGHV2-70*01_S6619 (A124G) of Genotype B12 of submission S00010, which was previously evaluated as IGHV2-70*01_S4660 of submission S00004 at Meeting 8. It was affirmed as a Level 0 sequence at that time. The sequence was seen in just 0.05% of all unmutated rearrangements, with 296 sequences including 93 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. Two other alleles were present in the genotype, and it is possible that one of these three sequences is an IGHV2-70D sequence. Haplotype data is supportive of the inference, but in light of the very low frequency of rearrangements seen and the complicated haplotype of this subject, it was affirmed as a Level 0 sequence. The sequence was affirmed up to and including nucleotide 319 even though alleles of IGHV2-70/IGHV2-70D in general extend up to and including base 322. However, the nucleotide composition of the subsequent three bases of genes associated with this inferred allele did not support their inference. It is however likely that three additional 3’ nucleotides are present in the sequence, and this is indicated in IARC and OGRDB publications by three dots at the end of the sequence. At the IARC Meeting 68, April 26th 2021, it was agreed that sequences affirmed by the IARC as Level 0 sequences, that subsequently have entered the IMGT germline gene database by other means, should be elevated to Level 1. At the IARC Meeting 69, May 18th 2021, IGHV2-70*i01 was elevated to Level 1. This sequence was incorporated into the IMGT germline gene database as a consequence of the IMGT-NC Report #2020-2-1008 (October 8th, 2020). The sequence was submitted to IMGT by Abdullah Gamal Dorgham, William Sinclair Gibson, Oscar Rodriguez and Corey Watson. The sequence recorded in OGRDB remains the sequence that was affirmed as the original IGHV2-70*i01 sequence. The sequence that is now recognized as IGHV2-70*20 includes the final three nucleotides of the sequence – TAC. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| Andrew Collins 2019-12-12 22:50:56 | Version 1 published Submission published by IARC on Dec 13, 2019. |
| Andrew Collins 2021-05-18 13:27:45 | Version 2 published IGHV2-70*i01 was elevated to Level 1 on May 18th 2021 at IARC Meeting 69, in recognition of the entry of this sequence into the IMGT germline gene database, as a result of submission of the sequence to IMGT by processes external to the IARC. |
| Mats Ohlin 2021-05-18 23:41:47 | IMGT Name updated to IGHV2-70*20 IMGT Name updated. |
| Mats Ohlin 2021-05-18 23:41:53 | IMGT Name updated to IGHV2-70*20 IMGT Name updated. |
| William Lees 2023-07-10 11:24:36 | Version 2 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2026-05-27 07:52:08 | Version 3 published Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| v2 | v3 | |
|---|---|---|
| Curator address | Birkbeck College, University of London, Malet Street, London | Clareo Biosciences, Louisville, Kentucky, USA |
| Alternative names | IGHV2-70*i01 | |
| Inference Type | Rearranged Only | Unrearranged and rearranged |
| Full Sequence | ||
| Coding Sequence | ||
| Gene start | 1 | 144 |
| Gene end | 298 | 444 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 133 | |
| L-PART2 End | 143 | |
| CDR1 Start | 76 | 219 |
| CDR1 End | 105 | 248 |
| CDR2 Start | 157 | 300 |
| CDR2 End | 177 | 320 |
| CDR3 Start | 292 | 435 |
| v_rs_start | 445 | |
| v_rs_end | 483 | |
| Extension? | True | False |
| 3' Extension | TAC | |
| curational_tags | likely_truncated | likely_full_length |
| Notes | changed |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGHV2-70*i01 | 1 | 2019-12-12 | |
| IGHV2-70*i01 | IGHV2-70*20 | 1 | 2021-05-18 |
| IGHV2-70*20 | IGHV2-70*20 | 2 | 2023-07-10 |
| IGHV2-70*20 | IGHV2-70*20 | 3 | 2026-05-27 |