| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGHV4-4*03 |
| IUIS Name | IGHV4-4*03 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged and rearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| MH779623 | Inferred | GenBank | 1 | 295 | ||
| SRX19354821 | V | Genbank | 1 | 474 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 215 |
| CDR1 End | 241 |
| CDR2 Start | 293 |
| CDR2 End | 313 |
| CDR3 Start | 428 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGAT |
| L-PART2 Start | 129 |
| L-PART2 End | 139 |
| L_PART2 | GGGTCCTGTCT |
| v_rs_start | 436 |
| v_rs_end | 474 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACACAAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A00008 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 4 |
| Release Date | 2026-05-27 |
| Release Notes | Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 4 |
| Gene Designation | 4 |
| Allele Designation | 03 |
| Gene start | 140 |
| Gene end | 435 |
Notes are added by IARC reviewers.
| Originally approved by IARC on April 13, 2018. “The sequence is present at relatively high frequency (0.6%), in the IgDiscover analysis. It was inferred by IgDiscover, TIger and Partis. Haplotype analysis showed two IGHV4-4-like sequences associated with the IGHJ6*02 haplotype – this inference and a second inference that is most similar to IGHV4-4*08. The likely major duplication of B16 is associated with the IGHJ6*03 haplotype. Given the similarities between IGHV4-4*08 and IGHV4-61, and given that this haplotype does not include an IGHV4-61 sequence, the committee concluded that this sequence could be accepted as Level 1. Although in this analysis the sequence was shown to be most similar to IGHV4-4*01, the committee believes that this inference extends the partial sequence IGHV4-4*03.” (April 12, 2019) In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 319. A trailing “.” indicates IARC’s opinion that the sequences likely to contain an additional/additional 3’ nucleotide(s) for which there is insufficient evidence to make an affirmation. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| Mats Ohlin 2018-12-21 12:16:43 | Version 1 published Submission published by IARC on Dec 21, 2018. |
| Mats Ohlin 2019-04-12 14:35:18 | Version 2 published In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 319. A trailing “.” indicates IARC’s opinion that the sequences likely to contain an additional/additional 3’ nucleotide(s) for which there is insufficient evidence to make an affirmation. |
| William Lees 2023-07-10 11:24:41 | Version 3 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2026-05-27 07:52:07 | Version 4 published Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| v3 | v4 | |
|---|---|---|
| Curator address | Birkbeck College, University of London, Malet Street, London | Clareo Biosciences, Louisville, Kentucky, USA |
| Alternative names | IGHV4-4*i01 | |
| Mapped | False | True |
| Inference Type | Rearranged Only | Unrearranged and rearranged |
| Full Sequence | ||
| Coding Sequence | ||
| Gene start | 1 | 140 |
| Gene end | 295 | 435 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 129 | |
| L-PART2 End | 139 | |
| CDR1 Start | 76 | 215 |
| CDR1 End | 102 | 241 |
| CDR2 Start | 154 | 293 |
| CDR2 End | 174 | 313 |
| CDR3 Start | 289 | 428 |
| v_rs_start | 436 | |
| v_rs_end | 474 | |
| Extension? | True | False |
| 3' Extension | A | |
| curational_tags | likely_truncated | likely_full_length |
| Notes | changed |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGHV4-4*i01 | IGHV4-4*03 (now extended) | 1 | 2018-12-21 |
| IGHV4-4*i01 | IGHV4-4*03 | 2 | 2019-04-12 |
| IGHV4-4*03 | IGHV4-4*03 | 3 | 2023-07-10 |
| IGHV4-4*03 | IGHV4-4*03 | 4 | 2026-05-27 |