Details

SpeciesHomo sapiens
Species subgroup
Subgroup type
Sequence NameIGHV4-4*03
IUIS NameIGHV4-4*03
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeUnrearranged and rearranged
MappedTrue
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEndCoding SequenceSC Coding Sequence
MH779623InferredGenBank1295
SRX19354821VGenbank1474

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start215
CDR1 End241
CDR2 Start293
CDR2 End313
CDR3 Start428

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGAT
L-PART2 Start129
L-PART2 End139
L_PART2GGGTCCTGTCT
v_rs_start436
v_rs_end474
V_HEPTAMERCACAGTG
V_NONAMERACACAAACC
Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA00008
CuratorWilliam Lees
Curator addressClareo Biosciences, Louisville, Kentucky, USA
Version4
Release Date2026-05-27
Release Notes

Repeat – had to roll back yesterday’s changes.

Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names

LocusIGH
Sequence TypeV
Gene Subgroup4
Gene Designation4
Allele Designation03
Gene start140
Gene end435

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Originally approved by IARC on April 13, 2018.

“The sequence is present at relatively high frequency (0.6%), in the IgDiscover analysis. It was inferred by IgDiscover, TIger and Partis. Haplotype analysis showed two IGHV4-4-like sequences associated with the IGHJ6*02 haplotype – this inference and a second inference that is most similar to IGHV4-4*08. The likely major duplication of B16 is associated with the IGHJ6*03 haplotype. Given the similarities between IGHV4-4*08 and IGHV4-61, and given that this haplotype does not include an IGHV4-61 sequence, the committee concluded that this sequence could be accepted as Level 1. Although in this analysis the sequence was shown to be most similar to IGHV4-4*01, the committee believes that this inference extends the partial sequence IGHV4-4*03.”

(April 12, 2019) In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 319. A trailing “.” indicates IARC’s opinion that the sequences likely to contain an additional/additional 3’ nucleotide(s) for which there is insufficient evidence to make an affirmation.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample MH779623

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Annotation is based on VDJbase record P25_I55_S1 for sample SC-19 (Genbank: SRX19354821).

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2018-12-21 12:16:43
Version 1 published

Submission published by IARC on Dec 21, 2018.

Mats Ohlin
2019-04-12 14:35:18
Version 2 published

In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 319. A trailing “.” indicates IARC’s opinion that the sequences likely to contain an additional/additional 3’ nucleotide(s) for which there is insufficient evidence to make an affirmation.

William Lees
2023-07-10 11:24:41
Version 3 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2026-05-27 07:52:07
Version 4 published

Repeat – had to roll back yesterday’s changes.

Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names

Changes from previous version

v3v4
Curator addressBirkbeck College, University of London, Malet Street, LondonClareo Biosciences, Louisville, Kentucky, USA
Alternative namesIGHV4-4*i01
MappedFalseTrue
Inference TypeRearranged OnlyUnrearranged and rearranged
Full Sequence
Coding Sequence
Gene start1140
Gene end295435
L-PART1 Start1
L-PART1 End46
L-PART2 Start129
L-PART2 End139
CDR1 Start76215
CDR1 End102241
CDR2 Start154293
CDR2 End174313
CDR3 Start289428
v_rs_start436
v_rs_end474
Extension?TrueFalse
3' ExtensionA
curational_tagslikely_truncatedlikely_full_length
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIUIS NameVersionDate
IGHV4-4*i01IGHV4-4*03 (now extended)12018-12-21
IGHV4-4*i01IGHV4-4*0322019-04-12
IGHV4-4*03IGHV4-4*0332023-07-10
IGHV4-4*03IGHV4-4*0342026-05-27