Details

SpeciesHomo sapiens
Species subgroup
Subgroup typenone
Sequence NameTRBV12-5*i01
IUIS Name
Alternative namesTRBV12-5*01_C28G_T140A
Affirmation Level0
Full Sequence
Coding Sequence
FunctionalityF
Inference TypeRearranged Only
MappedFalse
Paralogs
Paralog RepFalse

Evidence

The table below lists submissions to IARC , and the inferences within them, on which this IARC-affirmed sequence is based.

'Sequence Match' indicates whether the inference exactly matches the sequence, and clicking on the tick or cross will provide an alignment. Mismatches may be caused, for example, by the inclusion of leader sequences, or nucleotides in the inference which do not in IARC's opinion have sufficient evidence for inclusion in the sequence.

Submission IDAccession NoSubject IDGenotype NameSequence NameSequence Match
S00036 OW165662SC1P4_I21_S1_ogrdb_reportTRBV12-5*01_C28G_T140A

Supporting Observations

Sequences in other submitted genotypes that have been submitted to IARC and support the inference:

Submission IDSubject IDGenotype NameSequence NameSequence Match
S00036 C9P4_I9_S1_ogrdb_reportTRBV12-5*01_C28G_T140A

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele NameSubjectsSequence Match
TRBV12-5*01_c28g_t140a 3

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEndCoding SequenceSC Coding Sequence
MZ339646NonlocationalGenBank1378
MZ339646NonlocationalGenBank1378

CDR delineation

CDR1 Start79
CDR1 End93
CDR2 Start145
CDR2 End162
CDR3 Start277

Non-Core Regions

Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Additional Information

Sequence IDA03002
CuratorMats Ohlin
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version1
Release Date2023-12-29
Release Notes

Published as a level 0 sequence.

LocusTRB
Sequence TypeV
Gene Subgroup
Gene Designation
Allele Designation
Gene start1
Gene end290

Acknowledgements

Individuals acknowledged as contributing to this sequence:

NameInstitutionORCID ID
William LeesBirkbeck College, University of London, Malet Street, London

Notes

Notes are added by IARC reviewers.

The inference of TRBV12-5*01_C28G_T140A was discussed during IARC meeting 123 on June 2nd, 2023.

TRBV12-5*01_C28G_T140A (substitutions: H10D, M47K) has been inferred in three genotypes in the VDJbase P4 data set, including in VDJbase P4_I21_S1, a haplotypable data set (based on heterozygocity in TRBJ1-6). The genotype is also implied to carry TRBV12-5*01. No other gene in the IMGT database is highly similar to these alleles of TRBV12-5. The novel allele is the lesser expressed allele in the repertoire (33% allelic frequency; 0.19% of the total error-free population). It is represented by 58 error-free sequences and 56 unique CDR3s in the error-free set. Haplotyping based on allelic diversity in TRBJ1-6 demonstrates association of TRBV12-5*01 with only one of the haplotypes (TRBV12-5*01_C28G_T140A was not associated with any allele of TRBJ1-6).
The allele has also been inferred in a separate study and is reported in GenBank with accession number MZ339646 (Corcoran et al. (2023) Immunity 56, 635-652.E6 (DOI: 10.1016/j.immuni.2023.01.026)).

>MZ339646.1 Homo sapiens T-cell receptor TRB locus TRBV12-5*01_S2866 mRNA, partial cds
GATGCTAGAGTCACCCAGACACCAAGGGACAAGGTGACAGAGATGGGACAAGAAGTAACAATGAGATGTCAGCCAATTTTAGGCCACAATACTGTTTTCTGGTACAGACAGACCATGAAGCAAGGACTGGAGTTGCTGGCTTACTTCCGCAACCGGGCTCCTCTAGATGATTCGGGGATGCCGAAGGATCGATTCTCAGCAGAGATGCCTGATGCAACTTTAGCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTATTTTTGTGCTAGTGGTTTGGT

The allele has also been identified by genomic sequencing of sample HG01175 (Rodriguez et al. (2022) Cell Genom 2, 100228. doi: 10.1016/j.xgen.2022.100228)) in which it is reported in Supplementary Table S4 as sequence N_240.

>N_240
GATGCTAGAGTCACCCAGACACCAAGGGACAAGGTGACAGAGATGGGACAAGAAGTAACAATGAGATGTCAGCCAATTTTAGGCCACAATACTGTTTTCTGGTACAGACAGACCATGAAGCAAGGACTGGAGTTGCTGGCTTACTTCCGCAACCGGGCTCCTCTAGATGATTCGGGGATGCCGAAGGATCGATTCTCAGCAGAGATGCCTGATGCAACTTTAGCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTATTTTTGTGCTAGTGGTTTGGT

The low expression level of the allele and the lack of its association with the haplotypable TRBJ1-6 gene limits the validity of the transcriptomic data supporting the inference. As IARC focuses on high quality inference data as the primary source of information, it is considered that this particular inference does leave some room for doubt. Consequently, IARC affirms the sequence at Level 0. The inference of the complete sequence based solely on transcriptomic data is challenging also in this case. With the genomic data (from a different subject) as support it is acknowledged that the allele likely has a 3’-end identical to other alleles of TRBV12-5.

>TRBV12-5*01_C28G_T140A
GATGCTAGAGTCACCCAGACACCAAGGGACAAGGTGACAGAGATGGGACAAGAAGTAACAATGAGATGTCAGCCAATTTTAGGCCACAATACTGTTTTCTGGTACAGACAGACCATGAAGCAAGGACTGGAGTTGCTGGCTTACTTCCGCAACCGGGCTCCTCTAGATGATTCGGGGATGCCGAAGGATCGATTCTCAGCAGAGATGCCTGATGCAACTTTAGCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTATTTTTGTGCTAGTGGTTTGGT

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2023-12-29 21:47:39
Version 1 published

Published as a level 0 sequence.

Versions

All published versions of this sequence.

Sequence NameIUIS NameVersionDate
TRBV12-5*i0112023-12-29