The inference of TRBV12-5*01_C28G_T140A was discussed during IARC meeting 123 on June 2nd, 2023.

TRBV12-5*01_C28G_T140A (substitutions: H10D, M47K) has been inferred in three genotypes in the VDJbase P4 data set, including in VDJbase P4_I21_S1, a haplotypable data set (based on heterozygocity in TRBJ1-6). The genotype is also implied to carry TRBV12-5*01. No other gene in the IMGT database is highly similar to these alleles of TRBV12-5. The novel allele is the lesser expressed allele in the repertoire (33% allelic frequency; 0.19% of the total error-free population). It is represented by 58 error-free sequences and 56 unique CDR3s in the error-free set. Haplotyping based on allelic diversity in TRBJ1-6 demonstrates association of TRBV12-5*01 with only one of the haplotypes (TRBV12-5*01_C28G_T140A was not associated with any allele of TRBJ1-6).
The allele has also been inferred in a separate study and is reported in GenBank with accession number MZ339646 (Corcoran et al. (2023) Immunity 56, 635-652.E6 (DOI: 10.1016/j.immuni.2023.01.026)).

>MZ339646.1 Homo sapiens T-cell receptor TRB locus TRBV12-5*01_S2866 mRNA, partial cds
GATGCTAGAGTCACCCAGACACCAAGGGACAAGGTGACAGAGATGGGACAAGAAGTAACAATGAGATGTCAGCCAATTTTAGGCCACAATACTGTTTTCTGGTACAGACAGACCATGAAGCAAGGACTGGAGTTGCTGGCTTACTTCCGCAACCGGGCTCCTCTAGATGATTCGGGGATGCCGAAGGATCGATTCTCAGCAGAGATGCCTGATGCAACTTTAGCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTATTTTTGTGCTAGTGGTTTGGT

The allele has also been identified by genomic sequencing of sample HG01175 (Rodriguez et al. (2022) Cell Genom 2, 100228. doi: 10.1016/j.xgen.2022.100228)) in which it is reported in Supplementary Table S4 as sequence N_240.

>N_240
GATGCTAGAGTCACCCAGACACCAAGGGACAAGGTGACAGAGATGGGACAAGAAGTAACAATGAGATGTCAGCCAATTTTAGGCCACAATACTGTTTTCTGGTACAGACAGACCATGAAGCAAGGACTGGAGTTGCTGGCTTACTTCCGCAACCGGGCTCCTCTAGATGATTCGGGGATGCCGAAGGATCGATTCTCAGCAGAGATGCCTGATGCAACTTTAGCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTATTTTTGTGCTAGTGGTTTGGT

The low expression level of the allele and the lack of its association with the haplotypable TRBJ1-6 gene limits the validity of the transcriptomic data supporting the inference. As IARC focuses on high quality inference data as the primary source of information, it is considered that this particular inference does leave some room for doubt. Consequently, IARC affirms the sequence at Level 0. The inference of the complete sequence based solely on transcriptomic data is challenging also in this case. With the genomic data (from a different subject) as support it is acknowledged that the allele likely has a 3’-end identical to other alleles of TRBV12-5.

>TRBV12-5*01_C28G_T140A
GATGCTAGAGTCACCCAGACACCAAGGGACAAGGTGACAGAGATGGGACAAGAAGTAACAATGAGATGTCAGCCAATTTTAGGCCACAATACTGTTTTCTGGTACAGACAGACCATGAAGCAAGGACTGGAGTTGCTGGCTTACTTCCGCAACCGGGCTCCTCTAGATGATTCGGGGATGCCGAAGGATCGATTCTCAGCAGAGATGCCTGATGCAACTTTAGCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTATTTTTGTGCTAGTGGTTTGGT