Details


Species	Human_TCR
Species subgroup
Subgroup type	none
Sequence Name	TRBV12-5*i01
IUIS Name
Alternative names	TRBV12-5*01_C28G_T140A
Affirmation Level	0
Full Sequence
Coding Sequence
Functionality	F
Inference Type	Rearranged Only
Mapped	False
Paralogs
Paralog Rep	False

Evidence

The table below lists submissions to IARC , and the inferences within them, on which this IARC-affirmed sequence is based.

'Sequence Match' indicates whether the inference exactly matches the sequence, and clicking on the tick or cross will provide an alignment. Mismatches may be caused, for example, by the inclusion of leader sequences, or nucleotides in the inference which do not in IARC's opinion have sufficient evidence for inclusion in the sequence.

Submission ID	Accession No	Subject ID	Genotype Name	Sequence Name	Sequence Match
S00036	OW165662	SC1	P4_I21_S1_ogrdb_report	TRBV12-5*01_C28G_T140A

Supporting Observations

Sequences in other submitted genotypes that have been submitted to IARC and support the inference:

Submission ID	Subject ID	Genotype Name	Sequence Name	Sequence Match
S00036	C9	P4_I9_S1_ogrdb_report	TRBV12-5*01_C28G_T140A

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele Name	Subjects	Sequence Match
TRBV12-5*01_c28g_t140a	4

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

Accession	Type	Repository	Start	End
MZ339646	Nonlocational	GenBank
MZ339646	Nonlocational	GenBank

CDR delineation


CDR1 Start	79
CDR1 End	93
CDR2 Start	145
CDR2 End	162
CDR3 Start	277

Additional Information


Sequence ID	A03002
Curator	Mats Ohlin
Curator address	Dept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version	1
Release Date	2023-12-29
Release Notes	Published as a level 0 sequence.
Locus	TRB
Sequence Type	V
Gene Subgroup
Gene Designation
Allele Designation

Acknowledgements

Individuals acknowledged as contributing to this sequence:

Name	Institution	ORCID ID
William Lees	Birkbeck College, University of London, Malet Street, London

Notes

Notes are added by IARC reviewers.


The inference of TRBV12-501_C28G_T140A was discussed during IARC meeting 123 on June 2nd, 2023. TRBV12-501_C28G_T140A (substitutions: H10D, M47K) has been inferred in three genotypes in the VDJbase P4 data set, including in VDJbase P4_I21_S1, a haplotypable data set (based on heterozygocity in TRBJ1-6). The genotype is also implied to carry TRBV12-501. No other gene in the IMGT database is highly similar to these alleles of TRBV12-5. The novel allele is the lesser expressed allele in the repertoire (33% allelic frequency; 0.19% of the total error-free population). It is represented by 58 error-free sequences and 56 unique CDR3s in the error-free set. Haplotyping based on allelic diversity in TRBJ1-6 demonstrates association of TRBV12-501 with only one of the haplotypes (TRBV12-501_C28G_T140A was not associated with any allele of TRBJ1-6). The allele has also been inferred in a separate study and is reported in GenBank with accession number MZ339646 (Corcoran et al. (2023) Immunity 56, 635-652.E6 (DOI: 10.1016/j.immuni.2023.01.026)). >MZ339646.1 Homo sapiens T-cell receptor TRB locus TRBV12-501_S2866 mRNA, partial cds GATGCTAGAGTCACCCAGACACCAAGGGACAAGGTGACAGAGATGGGACAAGAAGTAACAATGAGATGTCAGCCAATTTTAGGCCACAATACTGTTTTCTGGTACAGACAGACCATGAAGCAAGGACTGGAGTTGCTGGCTTACTTCCGCAACCGGGCTCCTCTAGATGATTCGGGGATGCCGAAGGATCGATTCTCAGCAGAGATGCCTGATGCAACTTTAGCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTATTTTTGTGCTAGTGGTTTGGT The allele has also been identified by genomic sequencing of sample HG01175 (Rodriguez et al. (2022) Cell Genom 2, 100228. doi: 10.1016/j.xgen.2022.100228)) in which it is reported in Supplementary Table S4 as sequence N_240. >N_240 GATGCTAGAGTCACCCAGACACCAAGGGACAAGGTGACAGAGATGGGACAAGAAGTAACAATGAGATGTCAGCCAATTTTAGGCCACAATACTGTTTTCTGGTACAGACAGACCATGAAGCAAGGACTGGAGTTGCTGGCTTACTTCCGCAACCGGGCTCCTCTAGATGATTCGGGGATGCCGAAGGATCGATTCTCAGCAGAGATGCCTGATGCAACTTTAGCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTATTTTTGTGCTAGTGGTTTGGT The low expression level of the allele and the lack of its association with the haplotypable TRBJ1-6 gene limits the validity of the transcriptomic data supporting the inference. As IARC focuses on high quality inference data as the primary source of information, it is considered that this particular inference does leave some room for doubt. Consequently, IARC affirms the sequence at Level 0. The inference of the complete sequence based solely on transcriptomic data is challenging also in this case. With the genomic data (from a different subject) as support it is acknowledged that the allele likely has a 3’-end identical to other alleles of TRBV12-5. >TRBV12-5*01_C28G_T140A GATGCTAGAGTCACCCAGACACCAAGGGACAAGGTGACAGAGATGGGACAAGAAGTAACAATGAGATGTCAGCCAATTTTAGGCCACAATACTGTTTTCTGGTACAGACAGACCATGAAGCAAGGACTGGAGTTGCTGGCTTACTTCCGCAACCGGGCTCCTCTAGATGATTCGGGGATGCCGAAGGATCGATTCTCAGCAGAGATGCCTGATGCAACTTTAGCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTATTTTTGTGCTAGTGGTTTGGT

The inference of TRBV12-5*01_C28G_T140A was discussed during IARC meeting 123 on June 2nd, 2023.

TRBV12-5*01_C28G_T140A (substitutions: H10D, M47K) has been inferred in three genotypes in the VDJbase P4 data set, including in VDJbase P4_I21_S1, a haplotypable data set (based on heterozygocity in TRBJ1-6). The genotype is also implied to carry TRBV12-5*01. No other gene in the IMGT database is highly similar to these alleles of TRBV12-5. The novel allele is the lesser expressed allele in the repertoire (33% allelic frequency; 0.19% of the total error-free population). It is represented by 58 error-free sequences and 56 unique CDR3s in the error-free set. Haplotyping based on allelic diversity in TRBJ1-6 demonstrates association of TRBV12-5*01 with only one of the haplotypes (TRBV12-5*01_C28G_T140A was not associated with any allele of TRBJ1-6).
The allele has also been inferred in a separate study and is reported in GenBank with accession number MZ339646 (Corcoran et al. (2023) Immunity 56, 635-652.E6 (DOI: 10.1016/j.immuni.2023.01.026)).

>MZ339646.1 Homo sapiens T-cell receptor TRB locus TRBV12-5*01_S2866 mRNA, partial cds
GATGCTAGAGTCACCCAGACACCAAGGGACAAGGTGACAGAGATGGGACAAGAAGTAACAATGAGATGTCAGCCAATTTTAGGCCACAATACTGTTTTCTGGTACAGACAGACCATGAAGCAAGGACTGGAGTTGCTGGCTTACTTCCGCAACCGGGCTCCTCTAGATGATTCGGGGATGCCGAAGGATCGATTCTCAGCAGAGATGCCTGATGCAACTTTAGCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTATTTTTGTGCTAGTGGTTTGGT

The allele has also been identified by genomic sequencing of sample HG01175 (Rodriguez et al. (2022) Cell Genom 2, 100228. doi: 10.1016/j.xgen.2022.100228)) in which it is reported in Supplementary Table S4 as sequence N_240.

>N_240
GATGCTAGAGTCACCCAGACACCAAGGGACAAGGTGACAGAGATGGGACAAGAAGTAACAATGAGATGTCAGCCAATTTTAGGCCACAATACTGTTTTCTGGTACAGACAGACCATGAAGCAAGGACTGGAGTTGCTGGCTTACTTCCGCAACCGGGCTCCTCTAGATGATTCGGGGATGCCGAAGGATCGATTCTCAGCAGAGATGCCTGATGCAACTTTAGCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTATTTTTGTGCTAGTGGTTTGGT

The low expression level of the allele and the lack of its association with the haplotypable TRBJ1-6 gene limits the validity of the transcriptomic data supporting the inference. As IARC focuses on high quality inference data as the primary source of information, it is considered that this particular inference does leave some room for doubt. Consequently, IARC affirms the sequence at Level 0. The inference of the complete sequence based solely on transcriptomic data is challenging also in this case. With the genomic data (from a different subject) as support it is acknowledged that the allele likely has a 3’-end identical to other alleles of TRBV12-5.

>TRBV12-5*01_C28G_T140A
GATGCTAGAGTCACCCAGACACCAAGGGACAAGGTGACAGAGATGGGACAAGAAGTAACAATGAGATGTCAGCCAATTTTAGGCCACAATACTGTTTTCTGGTACAGACAGACCATGAAGCAAGGACTGGAGTTGCTGGCTTACTTCCGCAACCGGGCTCCTCTAGATGATTCGGGGATGCCGAAGGATCGATTCTCAGCAGAGATGCCTGATGCAACTTTAGCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTATTTTTGTGCTAGTGGTTTGGT

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.


Mats Ohlin 2023-12-29 21:47:39	Version 1 published Published as a level 0 sequence.

Versions

All published versions of this sequence.

Sequence Name	IMGT Name	Alternative names	Inference Type	Affirmation Level	Species subgroup	Subgroup type	Gene start	Gene end	UTR 5' Start	UTR 5' End	L-PART1 Start	L-PART1 End	L-PART2 Start	L-PART2 End	CDR1 Start	CDR1 End	CDR2 Start	CDR2 End	CDR3 Start	v_rs_start	v_rs_end	d_rs_3_prime_start	d_rs_3_prime_end	d_rs_5_prime_start	d_rs_5_prime_end	j_rs_start	j_rs_end	Codon Frame	Version	Date
TRBV12-5*i01		TRBV12-5*01_C28G_T140A	Rearranged Only	0		none	1	290							79	93	145	162	277									1	1	2023-12-29