Submission Details

Submission IDS00028
Submission Date2019-07-30 00:00:00
Submission Statusreviewing
SubmitterNéstor Vázquez Bernat
Submitter AddressKarolinska Institutet SE-171 77 Stockholm
SpeciesHuman
EthnicityUN

Inferred Sequences

The inferred novel alleles from each genotype that are submitted for review. This table lists all inferences put forward by the submitter. Where IARC has affirmed a sequence based on an inference, the corresponding sequence record will be listed in the Published column. Inferences for which no published sequence is shown have not been affirmed.

SequenceSubjectGenotypePublished
 IGHV3-20*01_S2478A007A007 VH
 IGHV3-21*01_S5868A007A007 VHA00037
 IGHV3-53*02_S0744A007A007 VHA00038
 IGKV1D-8*01_S8780A007A007 VK
 IGLV10-54*01_S4180A007A007 VL
 IGLV2-14*01_S5228A007A007 VL
 IGLV3-21*01_S5562A007A007 VL
 IGLV3-25*02_S7225A007A007 VL
 IGLV6-57*01_S1429A007A007 VL
 IGLV7-46*01_S3303A007A007 VL
 IGHV3-7*02_A318GA007A007 VHA00006

Genotypes

Each genotype that has been inferred, along with the descriptive name of the inference tool and settings that were used.

Genotype NameSubject IDLocusSequence TypeGenotype FilenameTool/Setting Name
 A007 VHA007IGHVVH_reanalysis_Nestor_ogrdb_report.csvIgDiscover
 A007 VKA007IGKVVK_reanalysis_Nestor_ogrdb_report.csvIgDiscover
 A007 VLA007IGLVVL_reanalysis_Nestor_ogrdb_report.csvIgDiscover

Acknowledgements

Individuals who should be acknowledged as contributing to the inferences listed in this submission.

No Items

Repertoire Details

Details of the repertoire from which the inferences are based. This corresponds, for example, to an NIH Project or an ENA study.

RepositoryENA
Accession NumberPRJEB30386
Project/Study TitleHigh-quality immunoglobulin library preparation for germline inference and repertoire expression analysis.
Dataset URLhttps://www.ebi.ac.uk/ena/data/view/PRJEB30386
MiAIRR Compliant?No
MiAIRR URL
Sequencing PlatformIllumina MiSeq
Read Length300nt
Primers Overlapping?No

Repertoire Publications

Publications associated with this study.

PubMed IDTitleAuthors
31024532High-Quality Library Preparation for NGS-Based Immunoglobulin Germline Gene Inference and Repertoire Expression Analysis.Vázquez Bernat N, Corcoran M, Hardt U, Kaduk M, Phad GE, Martin M, Karlsson Hedestam GB

Sequences of the PCR primers used in the study.

IgM 5'MTPX

IgM cDNA synthesis primer:
>Hu_IgM_MTPX
GGAGTTCAGACGTGTGCTCTTCCGATCTHHHHHACAHHHHHACAHHHHNHCCGACGGGGAATTCTCACAGGAGACGAGGGGGAAAAG

5’MTPX forward amplification set:
>Hu_VH_MTPX_1
CCTACACGACGCTCTTCCGATCTGGTGGCAGCAGTCACAGATGCCTACTC
>Hu_VH_MTPX_2
CCTACACGACGCTCTTCCGATCTGGTGGCAGCAGCCACAGGTGCCCACTC
>Hu_VH_MTPX_3
CCTACACGACGCTCTTCCGATCTGGTGGCAGCAGCTACAGGTGTCCAGTC
>Hu_VH_MTPX_4
CCTACACGACGCTCTTCCGATCTGGTGGSAGCAGCAACARGWGCCCACTC
>Hu_VH_MTPX_5
CCTACACGACGCTCTTCCGATCTGCTGGCTGTAGCTCCAGGTGCTCACTC
>Hu_VH_MTPX_6
CCTACACGACGCTCTTCCGATCTCCTGCTGCTGACCAYCCCTTCMTGGGTCTTGTC
>Hu_VH_MTPX_7
CCTACACGACGCTCTTCCGATCTCCTGCTACTGACTGTCCCGTCCTGGGTCTTATC
>Hu_VH_MTPX_8
CCTACACGACGCTCTTCCGATCTGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGTCCAGTG
>Hu_VH_MTPX_9
CCTACACGACGCTCTTCCGATCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGTCCARTG
>Hu_VH_MTPX_10
CCTACACGACGCTCTTCCGATCTGGATTTTCCTTGCTGCTATTTTAAAAGGTGTCCAGTG
>Hu_VH_MTPX_11
CCTACACGACGCTCTTCCGATCTGGGTTTTCCTTKTKGCTATWTTAGAAGGTGTCCAGTG
>Hu_VH_MTPX_12
CCTACACGACGCTCTTCCGATCTGGTGGCRGCTCCCAGATGGGTCCTGTC
>Hu_VH_MTPX_13
CCTACACGACGCTCTTCCGATCTCTGGCTGTTCTCCAAGGAGTCTGTG
>Hu_VH_MTPX_14
CCTACACGACGCTCTTCCGATCTGGCCTCCCATGGGGTGTCCTGTC
>Hu_VH_MTPX_15
CCTACACGACGCTCTTCCGATCTGGTGGCAGCAGCAACAGGTGCCCACT
>Hu_VH_MTPX_16
CACTCTTTCCCTACACGACGCTCTTCCGATCTATGGAACTGGGGCTCCGCTGGGTTTTCC
>Hu_VH_MTPX_17
CACTCTTTCCCTACACGACGCTCTTCCGATCTATGGACTGCACCTGGAGGATCCTCCTC
>Hu_VH_MTPX_18
CACTCTTTCCCTACACGACGCTCTTCCGATCTTGGCTGAGCTGGGTTTYCCTTGTTGC
>Hu_VH_MTPX_19
CACTCTTTCCCTACACGACGCTCTTCCGATCTGGAGTTKGGGCTGMGCTGGGTTTTCC
>Hu_VH_MTPX_20
CACTCTTTCCCTACACGACGCTCTTCCGATCTGCACCTGTGGTTTTTCCTCCTGCTGGTG
>Hu_VH_MTPX_21
CACTCTTTCCCTACACGACGCTCTTCCGATCTCACCTGTGGTTCTTCCTCCTSCTGG
>Hu_VH_MTPX_22
CACTCTTTCCCTACACGACGCTCTTCCGATCTCCAGGATGGGGTCAACCGCCATCCTC
>Hu_VH_MTPX_23
CTCTTTCCCTACACGACGCTCTTCCGATCTCAGAGGACTCACCATGGAGTTTGGGCTGAG
>Hu_VH_MTPX_24
CCTACACGACGCTCTTCCGATCTGGACTCACCATGGAGTTGGGACTGAGC
>Hu_VH_MTPX_25
CCTACACGACGCTCTTCCGATCTGGGCTGAGCTGGCTTTTTCTTGTGGC

No Items

IgK 5'MTPX

IgM cDNA synthesis primer:
>Hu_IgK_MTPX
GGAGTTCAGACGTGTGCTCTTCCGATCTHHHHHACAHHHHHACAHHHHNGGGATAGAAGTTATTCAGCAGGCACACAACAGAG

5’MTPX forward amplification set:
>Hu_VK_MTPX_1
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGTTGCCATCACAACTCATTGGGTTTCTG
>Hu_VK_MTPX_2
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGAARCCCCAGCGCAGCTTCTCTTCC
>Hu_VK_MTPX_3
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGAGGCTCCCTGCTCAGCTCTTGGGGCT
>Hu_VK_MTPX_4
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGAGGCTCCCTGCTCAGCTCCTGGGGCT
>Hu_VK_MTPX_5
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGACATGAGGGTCCCTGCTCAGC
>Hu_VK_MTPX_6
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGACATGAGRGTCCTCGCTCAGC
>Hu_VK_MTPX_7
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGAAGCCCCAGCACAGCTTCTTCTTCC
>Hu_VK_MTPX_8
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGAGGCTCCTTGCTCAGCTTCTGGGGCT
>Hu_VK_MTPX_9
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGAAGCCCCAGCTCAGCTTCTCTTCC
>Hu_VK_MTPX_10
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGACATGAGGGTCCCCGCTCAGC
>Hu_VK_MTPX_11
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGGGTCCCAGGTTCACCTCCTCAG
>Hu_VK_MTPX_12
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGTGTTGCAGACCCAGGTCTTCATTTC
>Hu_VK_MTPX_13
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGACATGAGGGTGCCCGCTCAGC
>Hu_VK_MTPX_14
CTCTTTCCCTACACGACGCTCTTCCGATCTCAGGAAGATGTYGCCATCACAACTCATTGG
>Hu_VK_MTPX_15
CACTCTTTCCCTACACGACGCTCTTCCGATCTCTCRCAATGAGGCTCCCTGCTCAGCTC
>Hu_VK_MTPX_16
CACTCTTTCCCTACACGACGCTCTTCCGATCTCCTGCTCAGCTCYTGGGGCTGCTAATGC
>Hu_VK_MTPX_17
CACTCTTTCCCTACACGACGCTCTTCCGATCTATGGACATGAGGGTGCCCGCTCAGCGCC
>Hu_VK_MTPX_18
CACTCTTTCCCTACACGACGCTCTTCCGATCTATGGACATGAGGGTSCCYGCTCAGCKCC
>Hu_VK_MTPX_19
CACTCTTTCCCTACACGACGCTCTTCCGATCTGCTCCTGGGGCTGCTAATGCTCTGG
>Hu_VK_MTPX_20
CACTCTTTCCCTACACGACGCTCTTCCGATCTGGGGCTCCTGCTGCTCTGGCTCC
>Hu_VK_MTPX_21
CACTCTTTCCCTACACGACGCTCTTCCGATCTGGACATGAGGGTCCCCGCTCAGCTCC

No Items

IgL 5'MTPX

IgM cDNA synthesis primer:
>Hu_IgL_MTPX
GGAGTTCAGACGTGTGCTCTTCCGATCTHHHHHACAHHHHHACAHHHHTGGCTTGRAGCTCCTCAGAGGAGG

5’MTPX forward amplification set:
>Hu_VL_MTPX_1
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGGCTCCACTACTTCTCACCCTCC
>Hu_VL_MTPX_2
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGTCCCCTCTCTTCCTCACCCT
>Hu_VL_MTPX_3
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGGCTCTGCTCCTCCTCACCCT
>Hu_VL_MTPX_4
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGAYCCCTCTCCTGCTCCCCCTC
>Hu_VL_MTPX_5
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGGCTCTGCTGCTCCTCACTCT
>Hu_VL_MTPX_6
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCATGGATCCCTCTCTTCCTCGGCGTC
>Hu_VL_MTPX_7
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCATGGGCCACACTCCTGCTCCCACTC
>Hu_VL_MTPX_8
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGGTCTCCTTCTACCTACTGCCCT
>Hu_VL_MTPX_9
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGACTCCTCTTCTTCTCTTGCTCCT
>Hu_VL_MTPX_10
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGACTCCTCTCCTCCTCCTGYTCC
>Hu_VL_MTPX_11
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGAGTGTCCCCACCATGGCCTGGATGATGC
>Hu_VL_MTPX_12
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGGCTCCTCTGCTCCTCACCCTCC
>Hu_VL_MTPX_13
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGRCCDGCTTCCCTCTCCTCCTCACCCT
>Hu_VL_MTPX_14
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGACCCCACTCCTCCTCCTCTTCC
>Hu_VL_MTPX_15
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGGCTCTGCTSCTCCTCASCCT
>Hu_VL_MTPX_16
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGATCCCTCTACTTCTCCCCCTC
>Hu_VL_MTPX_17
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGACCSCTCTCCTCCTCRGCCTC
>Hu_VL_MTPX_18
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGACTCTTCTCCTTCTCGTGCTCC
>Hu_VL_MTPX_19
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGTCTCCTCTCCTCCTCACTCT
>Hu_VL_MTPX_20
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGCCCTGGGCTCTGCTCCTCCTGACCCT
>Hu_VL_MTPX_21
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGACCCCTCTCTGGCTCACTCTC
>Hu_VL_MTPX_22
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGACCGCTCTCCTTCTGAGCCTC
>Hu_VL_MTPX_23
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCTTGGACCCCACTCCTCTTCCTCACC
>Hu_VL_MTPX_24
CTACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGACTCCTCTCTTTCTGTTCCTCC
>Hu_VL_MTPX_25
CACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGACTCTTCTCCTTCTCGTG
>Hu_VL_MTPX_26
CACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGACTCCTCTYCTYCTCYTG
>Hu_VL_MTPX_27
CACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGACCCCACTCCTCCTC
>Hu_VL_MTPX_28
CACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCTGGGTCTCCTTCTACCTACTGC
>Hu_VL_MTPX_29
CACTCTTTCCCTACACGACGCTCTTCCGATCTGCAGCATCGGAGGTGCCTCAGCCATG
>Hu_VL_MTPX_30
CACTCTTTCCCTACACGACGCTCTTCCGATCTGGCAGAACTCTGGGTGTCTCACCATG
>Hu_VL_MTPX_31
CACTCTTTCCCTACACGACGCTCTTCCGATCTGCAGCACTGGTGGTGCCTCAGCCATG
>Hu_VL_MTPX_32
CACTCTTTCCCTACACGACGCTCTTCCGATCTGGGCTCTGCTSCTCCTCACYCTCCT
>Hu_VL_MTPX_33
CACTCTTTCCCTACACGACGCTCTTCCGATCTGGGCTCTGCTCCTCCTGACCCTC

No Items

Inference Tools and Settings

Details of the inference tools and settings used to infer novel alleles. Each combination of tool and setting is listed here, and provided with a descriptive name.

Tool/Settings NameTool NameTool Version
 IgDiscoverIgDiscoverv0.10, Human branch (https://github.com/mateuszatki/IgDiscover/)

Notes

All the alleles have been genomically validated after reviewers request and their sequences have been submitted to genbank (MK587519-MK587529). Attached as well the plots of the genotype-statistics output for the three genotypes.

Attachment File Name
 VH_reanalysis_Nestor_ogrdb_plots.pdf
 VK_reanalysis_Nestor_ogrdb_plots.pdf
 VL_reanalysis_Nestor_ogrdb_plots.pdf