Notes

The germline set is based on sequences published in Watson et al. (2019)

Details

AuthorWilliam Lees
Lab Name
Lab AddressBirkbeck College, University of London, Malet Street, London
NameCAST/EiJ IGH
SpeciesMouse
Species subgroupCAST/EiJ
Subgroup typestrain
LocusIGH
Release Version1
Release DescriptionIGH sequences as described in Watson et al. (2019)
Release Date2022-05-14

Included Sequences

LabelVnDateIMGT NameAlt NamesFunctionalitySubgrpSequenceGapped Sequence
IGHD-AMU5 12022-05-14IGHD2-4*01|Mus_musculus_BALB/c,IGHD2-9*02|Mus_musculus_129/Svwatson_et_al:CAST_EiJ_IGHD2-4*01|IGHD2-9*02FCAST/EiJTCTACTATGATTACGACTCTACTATGATTACGAC
IGHD-EI4K 12022-05-14IGHD2-5*01|Mus_musculus_CB.20,IGHD2-6*01|Mus_musculus_C57BL/6Jwatson_et_al:CAST_EiJ_IGHD2-5*01|IGHD2-6*01FCAST/EiJCCTACTATAGTAACTACCCTACTATAGTAACTAC
IGHD-FQOA 12022-05-14IGHD4-1*02|Mus_musculus_BALB/cwatson_et_al:CAST_EiJ_IGHD4-1*02FCAST/EiJCAACTGGGACCAACTGGGAC
IGHD-G7BZ 12022-05-14IGHD4-1*01|Mus_musculus_BALB/cwatson_et_al:CAST_EiJ_IGHD4-1*01FCAST/EiJCTAACTGGGACCTAACTGGGAC
IGHD-IQWG 12022-05-14IGHD2-3*01|Mus_musculus_BALB/cwatson_et_al:CAST_EiJ_IGHD2-3*01FCAST/EiJTCTATGATGGTTACTACTCTATGATGGTTACTAC
IGHD-JK26 12022-05-14watson_et_al:CAST_EiJ_IGHD1-1_varFCAST/EiJTTTATTACTACAGTGGTAGCTACTTTATTACTACAGTGGTAGCTAC
IGHD-L36M 12022-05-14IGHD3-2*01|Mus_musculus_BALB/cwatson_et_al:CAST_EiJ_IGHD3-2*01FCAST/EiJAGACAGCTCGGGCTACAGACAGCTCGGGCTAC
IGHD-OODI 12022-05-14IGHD1-2*01|Mus_musculus_BALB/cwatson_et_al:CAST_EiJ_IGHD1-2*01FCAST/EiJTTCATTACTACGGCTACTTCATTACTACGGCTAC
IGHD-PKVJ 12022-05-14IGHD2-13*01|Mus_musculus_MRL/lprwatson_et_al:CAST_EiJ_IGHD2-13*01FCAST/EiJTCTACTATGGTGACTACTCTACTATGGTGACTAC
IGHJ-EGQA 12022-05-14IGHJ4*01|Mus_musculuswatson_et_al:CAST_EiJ_IGHJ4*01FCAST/EiJATTACTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGATTACTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAG
IGHJ-K6AI 12022-05-14IGHJ1*03|Mus_musculus_A/Jwatson_et_al:CAST_EiJ_IGHJ1*03FCAST/EiJCTACTGGTACTTCGATGTCTGGGGCACAGGGACCACGGTCACCGTCTCCTCAGCTACTGGTACTTCGATGTCTGGGGCACAGGGACCACGGTCACCGTCTCCTCAG
IGHJ-O6GC 12022-05-14watson_et_al:CAST_EiJ_IGHJ2_varFCAST/EiJACTACTTTGACTACTGGGGCCAAGGCACCACTATCACAGTCTCCTCAGACTACTTTGACTACTGGGGCCAAGGCACCACTATCACAGTCTCCTCAG
IGHJ-UP34 12022-05-14IGHJ3*01|Mus_musculuswatson_et_al:CAST_EiJ_IGHJ3*01FCAST/EiJCCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAGCCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAG
IGHV-2DBF 12022-05-14watson_et_al:CAST_EiJ_IGHV5-3FCAST/EiJGAAGTGAAGCTGGTGGAGTCTGAGGGAGGCTTAGTGCAGCCTGGAAGTTCCATGAAACTCTCCTGCACAGCCTCTGGATTCACTTTCAGTGACTATTACATGGCTTGGGTCCGCCAGGTTCCAGAAAAGGGTCTAGAATGGGTTGCAAACATTAATTATGATGGTAGTGGCACCTACTATCTGGACTCCTTGAAGAGCCGTTTCATCATCTCGAGAGACAATGCAAAGAACATTCTATACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCACGTATTACTGTGCAAGAAGTGAAGCTGGTGGAGTCTGAGGGA...GGCTTAGTGCAGCCTGGAAGTTCCATGAAACTCTCCTGCACAGCCTCTGGATTCACTTTC............AGTGACTATTACATGGCTTGGGTCCGCCAGGTTCCAGAAAAGGGTCTAGAATGGGTTGCAAACATTAATTATGAT......GGTAGTGGCACCTACTATCTGGACTCCTTGAAG...AGCCGTTTCATCATCTCGAGAGACAATGCAAAGAACATTCTATACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCACGTATTACTGTGCAA
IGHV-2ETO 12022-05-14watson_et_al:CAST_EiJ_IGHV8-2FCAST/EiJCAAGTTACTCTAAAAGAGTCTGGCCCTGGGATATTGAAGCCCTCACAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTACTAATATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGGATGATGATAAGTACTATAACCCATCCCTGAAGAGCCGGCTAACAATCTCCAAGGATACCTCCAGAAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACTTACTACTGTGCTCCAAGTTACTCTAAAAGAGTCTGGCCCT...GGGATATTGAAGCCCTCACAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTACTAATATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGGAT.........GATGATAAGTACTATAACCCATCCCTGAAG...AGCCGGCTAACAATCTCCAAGGATACCTCCAGAAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACTTACTACTGTGCTC
IGHV-33YF 12022-05-14watson_et_al:CAST_EiJ_IGHV1-15FCAST/EiJGAGATCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGGCTACTACATGCACTGGGTGAAGCAAAGTCCTGAAAAGAGCCTTGAGTGGATTGGAGAGATTAATCCTAGCACTGGTGGTACTACCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGAGATCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTC............ACTGGCTACTACATGCACTGGGTGAAGCAAAGTCCTGAAAAGAGCCTTGAGTGGATTGGAGAGATTAATCCTAGC......ACTGGTGGTACTACCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAA
IGHV-3BWA 12022-05-14IGHV1-12*01|Mus_musculus_C57BL/6watson_et_al:CAST_EiJ_IGHV1-1FCAST/EiJCAGGCTTATCTACAGCAGTCTGGGGCTGAGCTGGTGAGGCCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACATTTACCAGTTACAATATGCACTGGGTAAAGCAGACACCTAGACAGGGCCTGGAATGGATTGGAGCTATTTATCCAGGAAATGGTGATACTTCCTACAATCAGAAGTTCAAGGGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGCAGGCTTATCTACAGCAGTCTGGGGCT...GAGCTGGTGAGGCCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACATTT............ACCAGTTACAATATGCACTGGGTAAAGCAGACACCTAGACAGGGCCTGGAATGGATTGGAGCTATTTATCCAGGA......AATGGTGATACTTCCTACAATCAGAAGTTCAAG...GGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAG
IGHV-3FA4 12022-05-14watson_et_al:CAST_EiJ_IGHV4-2FCAST/EiJGAGGTGAAGCTTCTCGAGTCTGGAGGTGGCCTGGTGCAGCCTGGAGGATCCCTGAAACTCTCCTGTGCAGCCTCAGGATTCGATTTTAGTAAAGCCTGGATGAGTTGGGTCCGGCAGGCTACAGGGAAAGGGCTAGAATGGATTGGAGAAATTAGTCCAGGTAGCAGTACGATAAACTATACACCATCTCTAAAGGATAAATTCATCATCTCCAGAGACAACGCCAAAAATACGCTGTACCTGCAAATGAGCAAAGTGAGATCTGAGGACACAGCCCTTTATTACTGTGAGGTGAAGCTTCTCGAGTCTGGAGGT...GGCCTGGTGCAGCCTGGAGGATCCCTGAAACTCTCCTGTGCAGCCTCAGGATTCGATTTT............AGTAAAGCCTGGATGAGTTGGGTCCGGCAGGCTACAGGGAAAGGGCTAGAATGGATTGGAGAAATTAGTCCAGGT......AGCAGTACGATAAACTATACACCATCTCTAAAG...GATAAATTCATCATCTCCAGAGACAACGCCAAAAATACGCTGTACCTGCAAATGAGCAAAGTGAGATCTGAGGACACAGCCCTTTATTACTGT
IGHV-4QXK 12022-05-14watson_et_al:CAST_EiJ_IGHV1-13FCAST/EiJGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACATTCACTGACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTTATCCTAACAATGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGGAGGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACATTC............ACTGACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTTATCCTAAC......AATGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTG
IGHV-5CPP 12022-05-14watson_et_al:CAST_EiJ_IGHV5-5FCAST/EiJGACGTGAAGCTCGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATTACATGTCTTGGGCTCGGCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAATACTGGTGGTAGCACCTACTATCCAGACACTGTGAAGGGGCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAATTCTGAGGACACAGCCGTGTATTACTGTGACGTGAAGCTCGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATTACATGTCTTGGGCTCGGCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAATACT......GGTGGTAGCACCTACTATCCAGACACTGTGAAG...GGGCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAATTCTGAGGACACAGCCGTGTATTACTGT
IGHV-5QIY 12022-05-14watson_et_al:CAST_EiJ_IGHV6-3FCAST/EiJGAAGTGAAGCTTGAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCTTGTGCTGCCTCTGGATTCACTTTTAGTGACGCCTGGATGGACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTGAAATTAGAAACAAAGCTAGTAATTATGCAACGTATTATGCGGAGTCTGTGAAAGGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAGCTTAAGAGCTGAAGACACTGGCATTTATTACTGTGAAGTGAAGCTTGAGGAGTCTGGAGGA...GGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCTTGTGCTGCCTCTGGATTCACTTTT............AGTGACGCCTGGATGGACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTGAAATTAGAAACAAAGCTAGTAATTATGCAACGTATTATGCGGAGTCTGTGAAA...GGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAGCTTAAGAGCTGAAGACACTGGCATTTATTACTGT
IGHV-5RMF 12022-05-14watson_et_al:CAST_EiJ_IGHV9-6FCAST/EiJCAGATCCAGTTGGTGCAGTCTGGATCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAGACTATGGAATGAGCTGGGTGAAGCAGGCTCCAGGAAAAGGTTTAAAGTGGATGGGGTGGATAAACACCTACTCTGGAGAGCCAACATATGCTGATGACTTCAAGGGACGGTTTGCCTTTTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCCAGATCCAGTTGGTGCAGTCTGGATCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACAGACTATGGAATGAGCTGGGTGAAGCAGGCTCCAGGAAAAGGTTTAAAGTGGATGGGGTGGATAAACACCTAC......TCTGGAGAGCCAACATATGCTGATGACTTCAAG...GGACGGTTTGCCTTTTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGC
IGHV-5VGK 12022-05-14watson_et_al:CAST_EiJ_IGHV14-7FCAST/EiJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAAACCAGGGGCTTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAAGCAGCTATATACACTGGGTGAAGCAGAGGACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGCGAATGGTAATACTAAATATGCCCCGAAGTTCCAGGGCAAGGCCACTATAACTGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCTTGACATCTGAGGACACTGCCATCTATTACTGTGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAAACCAGGGGCTTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAAGCAGCTATATACACTGGGTGAAGCAGAGGACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGCG......AATGGTAATACTAAATATGCCCCGAAGTTCCAG...GGCAAGGCCACTATAACTGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCTTGACATCTGAGGACACTGCCATCTATTACTGT
IGHV-6HLN 12022-05-14watson_et_al:CAST_EiJ_IGHV1-2FCAST/EiJCAGGTTCAGTTGAAGCAGTCTGGAGCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTATATTATGCACTGGGTGAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATAGGATACTTTTTTCCTTACAATGATGATACTAAATGCAATGAGAAGTTCAAAGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGACTTCTGAGGACTCTGCCGTCTATTACTGTGCAACAGGTTCAGTTGAAGCAGTCTGGAGCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTATATTATGCACTGGGTGAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATAGGATACTTTTTTCCTTAC......AATGATGATACTAAATGCAATGAGAAGTTCAAA...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGACTTCTGAGGACTCTGCCGTCTATTACTGTGCAA
IGHV-6OTV 12022-05-14watson_et_al:CAST_EiJ_IGHV9-1FCAST/EiJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACATTCACAGACTATGCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCAACTCAGGTGTGCCAACATATGCTGATGACTTCAAGGGACGGTTTGTCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACATTC............ACAGACTATGCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCAAC......TCAGGTGTGCCAACATATGCTGATGACTTCAAG...GGACGGTTTGTCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTG
IGHV-766P 12022-05-14watson_et_al:CAST_EiJ_IGHV5-4FCAST/EiJGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGGCATGTCTTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTTGCATACATTAGTAGTGGCAGTAGTACCATCTACTATGCAGACACAGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTTCCTGCAAATGACCAGTCTAAGGTCTGAGGACACAGCCATGTATTACTGTGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATGGCATGTCTTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTTGCATACATTAGTAGTGGC......AGTAGTACCATCTACTATGCAGACACAGTGAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTTCCTGCAAATGACCAGTCTAAGGTCTGAGGACACAGCCATGTATTACTGT
IGHV-7TNO 12022-05-14watson_et_al:CAST_EiJ_IGHV1-25FCAST/EiJCAGGTCCAGCTGAAGCAGTCTGGAGCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTCACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAAAGATTGGTCCTGGAAGTGGTAGTACTTACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCAAGCAGGTCCAGCTGAAGCAGTCTGGAGCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTC............ACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAAAGATTGGTCCTGGA......AGTGGTAGTACTTACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCAAG
IGHV-7YGK 12022-05-14watson_et_al:CAST_EiJ_IGHV1-24FCAST/EiJGAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACCTTCACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAGAGATTTATCCTGGAAGTGGTAATACTTACTACAATGGGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAACACAGCCTACATGCAGCTCAGCAGCCTGATATCTGAGGACTCTGCAGTCTATTTCTGTGCGAGGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACCTTC............ACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAGAGATTTATCCTGGA......AGTGGTAATACTTACTACAATGGGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAACACAGCCTACATGCAGCTCAGCAGCCTGATATCTGAGGACTCTGCAGTCTATTTCTGTGC
IGHV-A2QL 12022-05-14watson_et_al:CAST_EiJ_IGHV1-5FCAST/EiJGAGGTCCAGCTGCAACAGTCTGGAGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACATTCACTGACTACAACATGGACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAACTATGATAGTACTATCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGACCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGGAGGTCCAGCTGCAACAGTCTGGAGCT...GAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACATTC............ACTGACTACAACATGGACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAAC......TATGATAGTACTATCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGACCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAG
IGHV-A4JN 12022-05-14watson_et_al:CAST_EiJ_IGHV11-1FCAST/EiJGAAGTGCAGCTGTTGGAGACTGGAGGAGGCTTGGTGCCACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTTAGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGATGGCAGTGCAATAAACTACGCACCATCCATAAAGGATCGCTTCACTATCTTCAGAGACAATGACAAGAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCTGAGGACACAGCCACGTATTTCTGTATGAGAGAAGTGCAGCTGTTGGAGACTGGAGGA...GGCTTGGTGCCACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTT............AGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGAT......GGCAGTGCAATAAACTACGCACCATCCATAAAG...GATCGCTTCACTATCTTCAGAGACAATGACAAGAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCTGAGGACACAGCCACGTATTTCTGTATGAGA
IGHV-A4OO 12022-05-14watson_et_al:CAST_EiJ_IGHV1-12FCAST/EiJGAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTCACTGACTACAACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCATTGAGTGGATTGGATATATTTATCCTAACAATGGTGGTACTGGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCGAGGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACAACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCATTGAGTGGATTGGATATATTTATCCTAAC......AATGGTGGTACTGGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGC
IGHV-ABAI 12022-05-14watson_et_al:CAST_EiJ_IGHV14-2FCAST/EiJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAGACAGCATTATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAGGATGGCGATACTGAATATGCCCCGAAGTTCCAGGACAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTGAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAGACAGCATTATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAG......GATGGCGATACTGAATATGCCCCGAAGTTCCAG...GACAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTGAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGT
IGHV-AGKP 12022-05-14watson_et_al:CAST_EiJ_IGHV6-2FCAST/EiJGAAGTGAAGCTTGAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTAGCCTCTGGATTCACTTTCAGTACCTACTGGATGTCCTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTGAAATTAGATTGAAATCTGATAATTATGCAACACATTATGCGGAGTCTGTGAAAGGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGGGCTGAAGACACTGGAATTTATTACTGCGAAGTGAAGCTTGAGGAGTCTGGAGGA...GGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTAGCCTCTGGATTCACTTTC............AGTACCTACTGGATGTCCTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTGAAATTAGATTGAAATCTGATAATTATGCAACACATTATGCGGAGTCTGTGAAA...GGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGGGCTGAAGACACTGGAATTTATTACTGC
IGHV-B5AR 12022-05-14watson_et_al:CAST_EiJ_IGHV1-7FCAST/EiJGAGGTCCAGCTGCAACAATCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTCACTGACTACTACATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTTACAACGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCGAGGTCCAGCTGCAACAATCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTC............ACTGACTACTACATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTTAC......AACGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGC
IGHV-BGWX 12022-05-14watson_et_al:CAST_EiJ_IGHV14-4FCAST/EiJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAGACAGCTTTATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATATGCCCCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAGACAGCTTTATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAG......GATGGTGAAACTAAATATGCCCCGAAGTTCCAG...GGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTG
IGHV-BHTL 12022-05-14watson_et_al:CAST_EiJ_IGHV1-4FCAST/EiJGAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAACCTGGGGCTTTAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTGACTACTACATAGACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGAAATTAATCCTTACAATGGTGATACTTTCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCTAGTACAGCCTACATGGAGCTCCGGAGCCTGACATCTGAGGACTCTGCAGTCTATTATTGTGCAAGGAGGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAACCTGGGGCTTTAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACTACATAGACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGAAATTAATCCTTAC......AATGGTGATACTTTCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCTAGTACAGCCTACATGGAGCTCCGGAGCCTGACATCTGAGGACTCTGCAGTCTATTATTGTGCAAG
IGHV-BQ3L 12022-05-14watson_et_al:CAST_EiJ_IGHV3-8FCAST/EiJGATGTGCAGCTTCAGGAGTCAGGACCTGGCCTCGTGAAACCCTCTCAGTCTCTGTCTCTCACCTGCTCTGTCACTGGCTACTCCATCACCAGTGGTTATTACTGGCACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGATACATAAGCAACGGTGGTAGCACTGACTACAACCCATCTCTCAAAAATCGAATCTCCATCACTCATGACACATCTAAGAACCAGTTCTTCCTGAAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCGATGTGCAGCTTCAGGAGTCAGGACCT...GGCCTCGTGAAACCCTCTCAGTCTCTGTCTCTCACCTGCTCTGTCACTGGCTACTCCATCACC.........AGTGGTTATTACTGGCACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGATACATAAGCAACGGT.........GGTAGCACTGACTACAACCCATCTCTCAAA...AATCGAATCTCCATCACTCATGACACATCTAAGAACCAGTTCTTCCTGAAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGC
IGHV-BRPO 12022-05-14IGHV3-5*01|Mus_musculus_C57BL/6watson_et_al:CAST_EiJ_IGHV3-7FCAST/EiJGATGTGCAGCTTCAGGAGTCAGGACCTGGCCTGGTGAAACCTTCTCAGACAGTGTTCCTCACCTGCACTGTCACTGGCATTTCCATCACCACTGGAAATTACAGGTGGAGCTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATAGGGTACATATACTACAGTGGTACCATTACCTACAATCCATCTCTCACAAGTCGAACCACCATCACTAGAGACACTCCCAAGAACCAGTTCTTCCTGGAAATGAACTCTTTGACTGCTGAGGACACAGCCACATACTACTGTGCACGGATGTGCAGCTTCAGGAGTCAGGACCT...GGCCTGGTGAAACCTTCTCAGACAGTGTTCCTCACCTGCACTGTCACTGGCATTTCCATCACC......ACTGGAAATTACAGGTGGAGCTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATAGGGTACATATACTACAGT.........GGTACCATTACCTACAATCCATCTCTCACA...AGTCGAACCACCATCACTAGAGACACTCCCAAGAACCAGTTCTTCCTGGAAATGAACTCTTTGACTGCTGAGGACACAGCCACATACTACTGTGCACG
IGHV-BVKM 12022-05-14watson_et_al:CAST_EiJ_IGHV5-8FCAST/EiJGAAGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAACTATTACATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAGAAATTAGTAGTGGTGGTGGTAACACCTACTATCCAGACAGTGTGAAGGGTCGATTCACCATCTCCAAAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATGTATTACTGTGCAAGGAAGTGAAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAACTATTACATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAGAAATTAGTAGTGGT......GGTGGTAACACCTACTATCCAGACAGTGTGAAG...GGTCGATTCACCATCTCCAAAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATGTATTACTGTGCAAG
IGHV-BVYW 12022-05-14watson_et_al:CAST_EiJ_IGHV3-3FCAST/EiJGATGTGCAGCTTCAGGAGTCAGGACCTGGCCTGGTGAAACCTTCTCAGTTACTTTCACTCACCTGCACTGTCACTGGCTACTCCATCACCAGTGGTTATAGCTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGTGGTAGCAATAACTACAACCCATCTCTCAAAAGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTTCCTGCAGTTGAATTCTGTGATTACTGAGGACACAGCCACATATTACTGTGCGATGTGCAGCTTCAGGAGTCAGGACCT...GGCCTGGTGAAACCTTCTCAGTTACTTTCACTCACCTGCACTGTCACTGGCTACTCCATCACC.........AGTGGTTATAGCTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGT.........GGTAGCAATAACTACAACCCATCTCTCAAA...AGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTTCCTGCAGTTGAATTCTGTGATTACTGAGGACACAGCCACATATTACTGTGC
IGHV-CAUP 12022-05-14watson_et_al:CAST_EiJ_IGHV6-1FCAST/EiJGAAGTGAAGCTTGAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTAGCCTCTGGATTCACTTTCAGTAACTCCTGGATGAACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTCAAATTAGATTGAAATCTGATAATTATGCAACACATTATGCGGAGTCTGTGAAAGGGAGGTTCACCATCTCAAGAGATGATTCCAGAAGTCGTCTCTACCTGCAAATGAACAGCTTAAGGGCTGAAGACACTGGAATTTATTACTGCGAAGTGAAGCTTGAGGAGTCTGGAGGA...GGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTAGCCTCTGGATTCACTTTC............AGTAACTCCTGGATGAACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTCAAATTAGATTGAAATCTGATAATTATGCAACACATTATGCGGAGTCTGTGAAA...GGGAGGTTCACCATCTCAAGAGATGATTCCAGAAGTCGTCTCTACCTGCAAATGAACAGCTTAAGGGCTGAAGACACTGGAATTTATTACTGC
IGHV-CMAO 12022-05-14watson_et_al:CAST_EiJ_IGHV1-20FCAST/EiJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATAAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGATATTTATCCTGGTAGTGGTAGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTGCCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATAAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGATATTTATCCTGGT......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTGC
IGHV-CNE7 12022-05-14watson_et_al:CAST_EiJ_IGHV5-2FCAST/EiJGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTTACATTCAGTAGCCATTTCATGGCATGGGTCCGCCAAACTCCAGAGAAAAGACTGGAGTGGGCCGCAAACATTTATCCTGATGGTGGTACCGCCTACTATCCAAACACTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAGGAATATCATGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGTAAGACAGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTTACATTC............AGTAGCCATTTCATGGCATGGGTCCGCCAAACTCCAGAGAAAAGACTGGAGTGGGCCGCAAACATTTATCCTGAT......GGTGGTACCGCCTACTATCCAAACACTGTGAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAGGAATATCATGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGTAAGACA
IGHV-COUF 12022-05-14watson_et_al:CAST_EiJ_IGHV14-8FCAST/EiJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAAACACCTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGCGAATGGTAATACTAAATATGCCCCGAAGTTCCAGGGCAAGGCCACTATAACTGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCATCTATTACTGTGGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAAACACCTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGCG......AATGGTAATACTAAATATGCCCCGAAGTTCCAG...GGCAAGGCCACTATAACTGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCATCTATTACTGTG
IGHV-CW44 12022-05-14watson_et_al:CAST_EiJ_IGHV9-2FCAST/EiJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACATTCACAGACTATGGAATGAACTGGGTGAAAGAGGTTCCAGGAAAGGGTTTCAAGTGGATGGGCTGGATAAACACCTACTCTGGAGTGCCAACATATGCTGACGCCTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACATTC............ACAGACTATGGAATGAACTGGGTGAAAGAGGTTCCAGGAAAGGGTTTCAAGTGGATGGGCTGGATAAACACCTAC......TCTGGAGTGCCAACATATGCTGACGCCTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTG
IGHV-D7P6 12022-05-14watson_et_al:CAST_EiJ_IGHV11-3FCAST/EiJGAAGTGCAGCTGTTGGAGACTGGAGGAGGCTTGGTGCAACCTGGGGGATCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTTAGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGATGGCAGTGCAATAAACTACGCACCATCCATAAAGGATCGATTCACTATCTTCAGAGACAATGACAAGAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCTGAGGACACAGCCACATATTTCTGTATGAGAGAAGTGCAGCTGTTGGAGACTGGAGGA...GGCTTGGTGCAACCTGGGGGATCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTT............AGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGAT......GGCAGTGCAATAAACTACGCACCATCCATAAAG...GATCGATTCACTATCTTCAGAGACAATGACAAGAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCTGAGGACACAGCCACATATTTCTGTATGAGA
IGHV-DWTN 12022-05-14watson_et_al:CAST_EiJ_IGHV9-7FCAST/EiJCAGATCCAGTTGGTACAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGACTTCTGGGTATATCTTCACAGACTATGGAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCAGAATAAACACCAAAACTGGTGTGCCAACATATGCTGAAGAGTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGCCAGATCCAGTTGGTACAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGACTTCTGGGTATATCTTC............ACAGACTATGGAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCAGAATAAACACCAAA......ACTGGTGTGCCAACATATGCTGAAGAGTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGC
IGHV-EFJY 12022-05-14watson_et_al:CAST_EiJ_IGHV1-9FCAST/EiJGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTCACTGACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAACACTGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACAGTAGACAAATCCCTCAGCACAGCCTACATGGAGCTCAACAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGGAGGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTC............ACTGACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAAC......ACTGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACAGTAGACAAATCCCTCAGCACAGCCTACATGGAGCTCAACAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTG
IGHV-EPJ3 12022-05-14watson_et_al:CAST_EiJ_IGHV11-4FCAST/EiJGAAGTGCAGCTGTTGGAGACTGGAGGAGGCTTGGTGCAACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTTAGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGATGGCAGTGCAATAAACTACGCACCATCCATAAAGGATCGATTCACTATCTTCAGAGACAATGACAAAAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCTGAGGACACAGCCACGTATTTCTGTGAAGTGCAGCTGTTGGAGACTGGAGGA...GGCTTGGTGCAACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTT............AGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGAT......GGCAGTGCAATAAACTACGCACCATCCATAAAG...GATCGATTCACTATCTTCAGAGACAATGACAAAAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCTGAGGACACAGCCACGTATTTCTGT
IGHV-FKCP 12022-05-14watson_et_al:CAST_EiJ_IGHV9-8FCAST/EiJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGACTTCTGGGTATACCTTCACAGACTATGGAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCAGAATAAACACCAAAACTGGTGTGCCAACATATGCTGAAGAGTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGCAACAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGACTTCTGGGTATACCTTC............ACAGACTATGGAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCAGAATAAACACCAAA......ACTGGTGTGCCAACATATGCTGAAGAGTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGCAA
IGHV-GDPO 12022-05-14watson_et_al:CAST_EiJ_IGHV8-1FCAST/EiJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTATGGTATGGGTGTAGGCTGGATTCGTCAGCCTTCGGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGAATGATAATAAGTACTATAACCCAACCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAGCAACCAGGTATTCCTCAAGATCGCCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCGACAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTATGGTATGGGTGTAGGCTGGATTCGTCAGCCTTCGGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGAAT.........GATAATAAGTACTATAACCCAACCCTGAAG...AGCCGGCTCACAATCTCCAAGGATACCTCCAGCAACCAGGTATTCCTCAAGATCGCCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCGA
IGHV-GOR4 12022-05-14watson_et_al:CAST_EiJ_IGHV1-26FCAST/EiJCAGGTTCAGCTGCAACAGTCTGACGCTGAGTTGGTGAAACCTGGAGCTTCAGTGAAGATATCCTGCAAGGTTTCTGGCTACACCTTCACTGACCATACTATTCACTGGATGAAGCAGAGGCCTGAACAGGGCCTGGAATGGATTGGATATATTTATCCTAGAGATGGTAGTACTAAGTACAATGAGAAGTTCAAGGGCAAGGCCACATTGACTGCAGATAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCAAGACAGGTTCAGCTGCAACAGTCTGACGCT...GAGTTGGTGAAACCTGGAGCTTCAGTGAAGATATCCTGCAAGGTTTCTGGCTACACCTTC............ACTGACCATACTATTCACTGGATGAAGCAGAGGCCTGAACAGGGCCTGGAATGGATTGGATATATTTATCCTAGA......GATGGTAGTACTAAGTACAATGAGAAGTTCAAG...GGCAAGGCCACATTGACTGCAGATAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCAAGA
IGHV-GVF5 12022-05-14watson_et_al:CAST_EiJ_IGHV14-5FCAST/EiJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAGACACCTATATGCACTGGGTGAAGCAGAGGACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATATGCCCCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCATCTATTACTGTGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAGACACCTATATGCACTGGGTGAAGCAGAGGACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAG......GATGGTGAAACTAAATATGCCCCGAAGTTCCAG...GGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCATCTATTACTGT
IGHV-HQ4S 12022-05-14watson_et_al:CAST_EiJ_IGHV3-5FCAST/EiJGATGTGCAGCTTCAGGAGTCAGGACCTGGCCTGGTGAAACCTTCTCAGTCACTTTCCCTCACCTGCACTGTCACTGGATACTCCATCACCAGTGGTTATGACTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGTGGTAGCAAGTACTACAACCCATCTCTCAAAAGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTCCCTGGAATTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCGATGTGCAGCTTCAGGAGTCAGGACCT...GGCCTGGTGAAACCTTCTCAGTCACTTTCCCTCACCTGCACTGTCACTGGATACTCCATCACC.........AGTGGTTATGACTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGT.........GGTAGCAAGTACTACAACCCATCTCTCAAA...AGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTCCCTGGAATTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGC
IGHV-HRAJ 12022-05-14watson_et_al:CAST_EiJ_IGHV2-3FCAST/EiJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACTTGCACTGTCTCTGGGTTTTCATTAACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGGTGGAAGCACAAATTATAATTCAGCTCTCATGTCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACTTGCACTGTCTCTGGGTTTTCATTA............ACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGGT.........GGAAGCACAAATTATAATTCAGCTCTCATG...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGT
IGHV-IAHS 12022-05-14watson_et_al:CAST_EiJ_IGHV3-4FCAST/EiJGATGTGCAGCTTCAGGAGTCAGGACCTGGCCTGGTGAAACCTTTTCAGTCACTTTCCCTCACCTGCACTGTCACTGGCTACTCCATCACCAGTGGTTACTGGAACTGGATCCGGAAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGTGGTAGCAATTACTACAACCCATCTCTCAAAAGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTTCCTGCAGTTGAATTCTATGACTACTGAGGACACAGCCACATATTACTGTGCGATGTGCAGCTTCAGGAGTCAGGACCT...GGCCTGGTGAAACCTTTTCAGTCACTTTCCCTCACCTGCACTGTCACTGGCTACTCCATC............ACCAGTGGTTACTGGAACTGGATCCGGAAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGT.........GGTAGCAATTACTACAACCCATCTCTCAAA...AGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTTCCTGCAGTTGAATTCTATGACTACTGAGGACACAGCCACATATTACTGTGC
IGHV-JC43 12022-05-14watson_et_al:CAST_EiJ_IGHV1-21FCAST/EiJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATGTCATGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATAACCTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGATATTTATCCTGGTAGTGGTAGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATGTCATGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATAACCTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGATATTTATCCTGGT......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGT
IGHV-JCQC 12022-05-14watson_et_al:CAST_EiJ_IGHV1-11FCAST/EiJGAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTGACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGGTATTAATCCTAACAATGGTGGTACTGGCTACAACCAGAAGTTCAAGGGTAAGTCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACGCTGCAGTCTATTACTGTGCAAGAGAGGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGGTATTAATCCTAAC......AATGGTGGTACTGGCTACAACCAGAAGTTCAAG...GGTAAGTCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACGCTGCAGTCTATTACTGTGCAAGA
IGHV-JL75 12022-05-14watson_et_al:CAST_EiJ_IGHV1-31FCAST/EiJCAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGACTTCTGGCTACACCTTCACCAGCTACTGGATTCAGTGGGTAAAACAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAGAGATATTTCCTGGAACTGGCACTACTTACTACAATGAGATGTTCAAGGACAAGGCCACATTCACTGCAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACCTCTGAGGACTCTGCTGTCTATTTCTGTGCACAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGACTTCTGGCTACACCTTC............ACCAGCTACTGGATTCAGTGGGTAAAACAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAGAGATATTTCCTGGA......ACTGGCACTACTTACTACAATGAGATGTTCAAG...GACAAGGCCACATTCACTGCAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACCTCTGAGGACTCTGCTGTCTATTTCTGTGCA
IGHV-JXHT 12022-05-14watson_et_al:CAST_EiJ_IGHV1-22FCAST/EiJAAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTAGTGAAACCCGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACTGAGTATATTATACACTGGGTAAAGCAGAGGTCTGGACAGGGTCTTGAGTGGATTGGGTGGTTTTACCCTGGAAGTGGTAGTATAAAGTACAATGAGAAATTCAAGGACAAGGCCACATTGACTGCGGACAAATCCTCCAGCACAGTCTATATGGAGCTTAGTAGATTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGACACGAAAAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTAGTGAAACCCGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACTGAGTATATTATACACTGGGTAAAGCAGAGGTCTGGACAGGGTCTTGAGTGGATTGGGTGGTTTTACCCTGGA......AGTGGTAGTATAAAGTACAATGAGAAATTCAAG...GACAAGGCCACATTGACTGCGGACAAATCCTCCAGCACAGTCTATATGGAGCTTAGTAGATTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGACACGAA
IGHV-KDFG 12022-05-14watson_et_al:CAST_EiJ_IGHV7-1FCAST/EiJGAGGTGAAGCTGATGGAATCTGGAGGAGGCTTGGTACAGCCTGGGGGTTCTCTGAGTCTCTCCTGTGCAGCTTCTGGATTCACCTTTACTGATTACTACATGAGCTGGGTCCGCCAGCATCCAGGGAAGGCACCTGAGTGGTTGGCTTTGATTAGAAACAAAGCTAATGGTTACACAACAGAGTATACTGCATCTGTTAAGGGTCGGTTCACCATCTCCAGAGATAATTCCCAAAACATCCTCTATCTTCAAATGAACACCCTGAGGGCTGAGGACAGTGCCACTTATTACTGTGAGGTGAAGCTGATGGAATCTGGAGGA...GGCTTGGTACAGCCTGGGGGTTCTCTGAGTCTCTCCTGTGCAGCTTCTGGATTCACCTTT............ACTGATTACTACATGAGCTGGGTCCGCCAGCATCCAGGGAAGGCACCTGAGTGGTTGGCTTTGATTAGAAACAAAGCTAATGGTTACACAACAGAGTATACTGCATCTGTTAAG...GGTCGGTTCACCATCTCCAGAGATAATTCCCAAAACATCCTCTATCTTCAAATGAACACCCTGAGGGCTGAGGACAGTGCCACTTATTACTGT
IGHV-KI3H 12022-05-14watson_et_al:CAST_EiJ_IGHV1-30FCAST/EiJCAGGTTCAGCTGCAGCAGTCTGGAGCTGAGCTGATGAAGCCTGGGGCCTCAGTGAAGCTTTCCTGCAAGGCTACTGGCTACACATTCACTGGCTACTGGATAGAGTGGGTAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGAGATTTTACCTGGAAGTGATAGTACTAACTACAATGAGAAGTTCAAGGGCAAGGCCACATTCACTGCAGATACATCCTCCAACACAGCCTACATGCAACTCAGCAGCCTGACAACTGAGGACTCTGCCATCTATTACTGTCAGGTTCAGCTGCAGCAGTCTGGAGCT...GAGCTGATGAAGCCTGGGGCCTCAGTGAAGCTTTCCTGCAAGGCTACTGGCTACACATTC............ACTGGCTACTGGATAGAGTGGGTAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGAGATTTTACCTGGA......AGTGATAGTACTAACTACAATGAGAAGTTCAAG...GGCAAGGCCACATTCACTGCAGATACATCCTCCAACACAGCCTACATGCAACTCAGCAGCCTGACAACTGAGGACTCTGCCATCTATTACTGT
IGHV-KXNU 12022-05-14watson_et_al:CAST_EiJ_IGHV1-27FCAST/EiJCAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAAGCTTCTGGCTACGCATTCAGTAGCTCCTGGATGAACTGGGTGAAGCAGAGGCCTGGAAAGGGTCTTGAGTGGATTGGATGGATTTATCCTGGAGATGGTGATACTAACTACAATGGAAAGTTCAAGGGCAAGGCAACACTGACTGCAGACAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCCAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAAGCTTCTGGCTACGCATTC............AGTAGCTCCTGGATGAACTGGGTGAAGCAGAGGCCTGGAAAGGGTCTTGAGTGGATTGGATGGATTTATCCTGGA......GATGGTGATACTAACTACAATGGAAAGTTCAAG...GGCAAGGCAACACTGACTGCAGACAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGC
IGHV-KZN5 12022-05-14watson_et_al:CAST_EiJ_IGHV9-4FCAST/EiJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAGACTATTCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCTACACTGGAGAGCCAACATATGCTGAAGAGTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGCCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACAGACTATTCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCTAC......ACTGGAGAGCCAACATATGCTGAAGAGTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGC
IGHV-L7TC 12022-05-14watson_et_al:CAST_EiJ_IGHV1-8FCAST/EiJGAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTCAAGATATCCTGCAAGGCTTCTGGTTACTCATTTACTGGCTACTTTATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACGTATTAATCCTTACAATGGTGATACTTTCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCTAGCACAGCCCACATGGAGCTCCGGAGCCTGACATCTGAGGACTCTGCAGTCTATTATTGTGCAAGAGAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTCAAGATATCCTGCAAGGCTTCTGGTTACTCATTT............ACTGGCTACTTTATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACGTATTAATCCTTAC......AATGGTGATACTTTCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCTAGCACAGCCCACATGGAGCTCCGGAGCCTGACATCTGAGGACTCTGCAGTCTATTATTGTGCAAGA
IGHV-LHW4 12022-05-14watson_et_al:CAST_EiJ_IGHV1-14FCAST/EiJGAGATCCAGCTGCAGCAGACTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTATTCATTCACTGACTACATCATGCTCTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAAATATTAATCCTTACTATGGTAGTACTAGCTACAATCAGAAGTTCAAGGGAAAGGCCACATTGACTGTAGACAAATCTTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAGAGATCCAGCTGCAGCAGACTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTATTCATTC............ACTGACTACATCATGCTCTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAAATATTAATCCTTAC......TATGGTAGTACTAGCTACAATCAGAAGTTCAAG...GGAAAGGCCACATTGACTGTAGACAAATCTTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCA
IGHV-LOR6 12022-05-14watson_et_al:CAST_EiJ_IGHV1-18FCAST/EiJCAGGTCCAATTGCAGCAGCCTGGGGCTGAACTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTCACAAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGATATATTTATCCTCGTAGTGGTAGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCCAGGTCCAATTGCAGCAGCCTGGGGCT...GAACTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACAAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGATATATTTATCCTCGT......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGC
IGHV-LWU7 12022-05-14watson_et_al:CAST_EiJ_IGHV5-7FCAST/EiJGAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAACCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGGCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAGTGGTGGTGGTAACACCTACTATCCAGACAGTGTGAAGGGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTTTGAAGTCTGAGGACACAGCCATGTATTACTGTGCGAAGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAACCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATGGCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAGTGGT......GGTGGTAACACCTACTATCCAGACAGTGTGAAG...GGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTTTGAAGTCTGAGGACACAGCCATGTATTACTGTGC
IGHV-M2M2 12022-05-14watson_et_al:CAST_EiJ_IGHV1-33FCAST/EiJGAGGTCCAGCTGCAACAGTCTGGACCTGAGTTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACCTTCACTGACTACAACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTAATCCTTATAATGATTATACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACTTTGACTGTAGACAAATCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCGAGGTCCAGCTGCAACAGTCTGGACCT...GAGTTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACCTTC............ACTGACTACAACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTAATCCTTAT......AATGATTATACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACTTTGACTGTAGACAAATCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGC
IGHV-MGVJ 12022-05-14watson_et_al:CAST_EiJ_IGHV3-2FCAST/EiJGATGTGCAGCTTCAGGAGTCAGGACCTGGCCTGGTGAAACCTTCTCAGTTACTTTCACTCACCTGCACTGTCACTGGCTACTCCATCACCAGTGGTTATGACTGGCACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGTGGTAGCAATTACTACAACCCATCTCTCAAAAGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTTCCTGCAGTTGAATTCTGTGATTACTGAGGACACAGCCACATATTACTGTGCGATGTGCAGCTTCAGGAGTCAGGACCT...GGCCTGGTGAAACCTTCTCAGTTACTTTCACTCACCTGCACTGTCACTGGCTACTCCATCACC.........AGTGGTTATGACTGGCACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGT.........GGTAGCAATTACTACAACCCATCTCTCAAA...AGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTTCCTGCAGTTGAATTCTGTGATTACTGAGGACACAGCCACATATTACTGTGC
IGHV-MJHC 12022-05-14IGHV2-2*01|Mus_musculus_C57BL/6watson_et_al:CAST_EiJ_IGHV2-1FCAST/EiJCAGGTGCAGCTGAAGCAGTCAGGACCTGGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTAACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGTGGAAGCACAGACTATAATGCAGCTTTCATATCCAGACTGAGCATCAGCAAGGACAATTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATATTACTGTGCCACAGGTGCAGCTGAAGCAGTCAGGACCT...GGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTA............ACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGT.........GGAAGCACAGACTATAATGCAGCTTTCATA...TCCAGACTGAGCATCAGCAAGGACAATTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATATTACTGTGCCA
IGHV-MJS4 12022-05-14watson_et_al:CAST_EiJ_IGHV15-1FCAST/EiJCAGGTTCACCTACAACAGTCTGGTTCTGAACTGAGGAGTCCTGGGTCTTCAGTAAAGCTGTCATGCAAGGATTTTGATTCAGAAGTCTTCCCTATTGCTTATATGAGTTGGGTAAGGCAGAAGCCTGGGCATGGATTTGAATGGATTGGAGACATACTCCCAAGTATTGGTAGAACAATCTATGGAGAGAAGTTTGAGGACAAAGCCACACTGGATGCAGACACAGCGTCCAACACAGCCTACTTGGAGCTCAACAGTCTGACATCTGAGGACTCTGCTATCTACTACTGTGCAAGCAGGTTCACCTACAACAGTCTGGTTCT...GAACTGAGGAGTCCTGGGTCTTCAGTAAAGCTGTCATGCAAGGATTTTGATTCAGAAGTCTTC.........CCTATTGCTTATATGAGTTGGGTAAGGCAGAAGCCTGGGCATGGATTTGAATGGATTGGAGACATACTCCCAAGT......ATTGGTAGAACAATCTATGGAGAGAAGTTTGAG...GACAAAGCCACACTGGATGCAGACACAGCGTCCAACACAGCCTACTTGGAGCTCAACAGTCTGACATCTGAGGACTCTGCTATCTACTACTGTGCAAG
IGHV-N7SW 12022-05-14IGHV10S3*01|Mus_musculus_BALB/cwatson_et_al:CAST_EiJ_IGHV10-1FCAST/EiJGAGGTGCAGCTTGTTGAGACTGGTGGAGGATTGGTGCAGCCTAAAGGGTCATTGAAACTCTCATGTGCAGCCTCTGGATTCACCTTCAATACCAATGCCATGAACTGGGTCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTAATAATTATGCAACATATTATGCCGATTCAGTGAAAGACAGGTTCACCATCTCCAGAGATGATTCACAAAGCATGCTCTATCTGCAAATGAACAACTTGAAAACTGAGGACACAGCCATGTATTACTGTGGAGGTGCAGCTTGTTGAGACTGGTGGA...GGATTGGTGCAGCCTAAAGGGTCATTGAAACTCTCATGTGCAGCCTCTGGATTCACCTTC............AATACCAATGCCATGAACTGGGTCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTAATAATTATGCAACATATTATGCCGATTCAGTGAAA...GACAGGTTCACCATCTCCAGAGATGATTCACAAAGCATGCTCTATCTGCAAATGAACAACTTGAAAACTGAGGACACAGCCATGTATTACTGTG
IGHV-NTLL 12022-05-14watson_et_al:CAST_EiJ_IGHV3-9FCAST/EiJGAGGTGCAGCTTCAGGAGTCAGGACCTGGCCTGGTGAAACCTTCTCAAACTCTGTCCCTCACCTGTTCTGTCACTGGCTACTCCATCACCAATGATTACTGGAACTGGATCCGGAAATTCCCAGGGAATAAACTTGAGTACATGGGGTACATAAGCTACAGAGGCACTTACTACAATCCATCTCTCAAAAGTCGAATCTCCATCACTCAAGACACATCCAAGAACCAGTACTACCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTTGAGGTGCAGCTTCAGGAGTCAGGACCT...GGCCTGGTGAAACCTTCTCAAACTCTGTCCCTCACCTGTTCTGTCACTGGCTACTCCATC............ACCAATGATTACTGGAACTGGATCCGGAAATTCCCAGGGAATAAACTTGAGTACATGGGGTACATAAGCTACAGA.........GGCACTTACTACAATCCATCTCTCAAAAGT...CGAATCTCCATCACTCAAGACACATCCAAGAACCAGTACTACCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTT
IGHV-PWKC 12022-05-14watson_et_al:CAST_EiJ_IGHV9-5FCAST/EiJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCCGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGCTATACCTTCACAAACTATGCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCGTGATATACACCGACACTGGAGAGCCAACATATGCTGAAGAGTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCCGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGCTATACCTTC............ACAAACTATGCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCGTGATATACACCGAC......ACTGGAGAGCCAACATATGCTGAAGAGTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTG
IGHV-QCJW 12022-05-14watson_et_al:CAST_EiJ_IGHV1-10FCAST/EiJGAGGTCCAGCTGCAACAATCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTCACTGACTACTACATGAAGTGGGTGAAGCAGAGCCCTGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAACAATGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCGAGGTCCAGCTGCAACAATCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTC............ACTGACTACTACATGAAGTGGGTGAAGCAGAGCCCTGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAAC......AATGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGC
IGHV-QELY 12022-05-14watson_et_al:CAST_EiJ_IGHV1-3FCAST/EiJCAGGTTCAACTGCAGCAGTCTGGGGCTGAGCTGGTGAGGCCTGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCGGGCTACACATTTACTGACTATGAAATGGACTGGGTGAAGCAGACACCTGTGCATGGCCTGGAATGGATTGGAGCTATTAATCCTGAAACTGGTGGTACTGCCTACAATCAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTATATGGAGCTCAGCAGCCTGACATCTGAGGACTCTGCTGTCTATTACTGTACCAGGTTCAACTGCAGCAGTCTGGGGCT...GAGCTGGTGAGGCCTGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCGGGCTACACATTT............ACTGACTATGAAATGGACTGGGTGAAGCAGACACCTGTGCATGGCCTGGAATGGATTGGAGCTATTAATCCTGAA......ACTGGTGGTACTGCCTACAATCAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTATATGGAGCTCAGCAGCCTGACATCTGAGGACTCTGCTGTCTATTACTGTAC
IGHV-QFNR 12022-05-14watson_et_al:CAST_EiJ_IGHV9-3FCAST/EiJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAGACTATTCAATTCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGTGTTGGATAAACACCTACACTGGAGTGCCAACATATGCTGAAGAGTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGCCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACAGACTATTCAATTCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGTGTTGGATAAACACCTAC......ACTGGAGTGCCAACATATGCTGAAGAGTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGC
IGHV-R5FY 12022-05-14watson_et_al:CAST_EiJ_IGHV11-2FCAST/EiJGAAGTGCAGCTGTTGGAGACTGGAGGAGGCTTGGTGCAACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTTAGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGAACCTGGAGTGGATTGGAGACATTAATTCTGATGGCAGTGCAATAAACTACGCACCATCCATAAAGGATCGATTCACTATCTTCAGAGACAATGACAAGAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCGGAGGACACAGCCACGTATTTCTGTATGAAGTGCAGCTGTTGGAGACTGGAGGA...GGCTTGGTGCAACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTT............AGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGAACCTGGAGTGGATTGGAGACATTAATTCTGAT......GGCAGTGCAATAAACTACGCACCATCCATAAAG...GATCGATTCACTATCTTCAGAGACAATGACAAGAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCGGAGGACACAGCCACGTATTTCTGTAT
IGHV-R5V2 12022-05-14watson_et_al:CAST_EiJ_IGHV14-1FCAST/EiJGAGGTTCAGCTGCAGCAGTCTGGGACAGAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAGACAGCATTATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAGGATGGCGATACTGAATATGCCCCGAAGTTCCAGGACAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTGAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGAGGTTCAGCTGCAGCAGTCTGGGACA...GAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAGACAGCATTATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAG......GATGGCGATACTGAATATGCCCCGAAGTTCCAG...GACAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTGAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGT
IGHV-R76P 12022-05-14watson_et_al:CAST_EiJ_IGHV3-1FCAST/EiJGATGTGCAGCTTCAGGAGTCAGGACCTGGCCTGGTGAAACCTTCTCAGTCACTTTCCCTCACCTGCACTGTCACTGGCTACTCCATCACCAGTGGTTATAGCTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGTGGTAGCAATTACTACAACCCATCTCTCAAAAGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTCCCTGGAATTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCAAGATGTGCAGCTTCAGGAGTCAGGACCT...GGCCTGGTGAAACCTTCTCAGTCACTTTCCCTCACCTGCACTGTCACTGGCTACTCCATCACC.........AGTGGTTATAGCTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGT.........GGTAGCAATTACTACAACCCATCTCTCAAA...AGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTCCCTGGAATTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCAA
IGHV-RM7V 12022-05-14watson_et_al:CAST_EiJ_IGHV14-6FCAST/EiJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAGACTACTATATGCACTGGGTGAAGCAGAGGACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATATGCCCCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAGACTACTATATGCACTGGGTGAAGCAGAGGACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAG......GATGGTGAAACTAAATATGCCCCGAAGTTCCAG...GGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTG
IGHV-RR3Z 12022-05-14watson_et_al:CAST_EiJ_IGHV6-4FCAST/EiJGAAGTGAAGCTTGAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGCTGCCTCTGGATTCACTTTCAGTAACTACTGGATGGATTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTGAAATTAGAAACAAAGCTAGTAATTATGCAACGTATTATGCGGAGTCTGTGAAAGGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAGCTTAAGAGCTGAAGACACTGGCATTTATTACTGTGAAGTGAAGCTTGAGGAGTCTGGAGGA...GGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGCTGCCTCTGGATTCACTTTC............AGTAACTACTGGATGGATTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTGAAATTAGAAACAAAGCTAGTAATTATGCAACGTATTATGCGGAGTCTGTGAAA...GGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAGCTTAAGAGCTGAAGACACTGGCATTTATTACTGT
IGHV-SJLD 12022-05-14watson_et_al:CAST_EiJ_IGHV5-1FCAST/EiJGAAGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGCCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAAGCTGGAGTGGGTCGCAGCCATTAGTAGTAATGGTGGTAGCACCTATTATCCAGACACTGTAAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACAGCCTTGTATTACTGTGCAAGGAAGTGAAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATGCCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAAGCTGGAGTGGGTCGCAGCCATTAGTAGTAAT......GGTGGTAGCACCTATTATCCAGACACTGTAAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACAGCCTTGTATTACTGTGCAAG
IGHV-SLAG 12022-05-14IGHV1-47*01|Mus_musculus_C57BL/6watson_et_al:CAST_EiJ_IGHV1-16FCAST/EiJCAGGTTCAGCTGCAGCAGTCTGGGGCTGAGCTAGTGAAGCCTGGAGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTCACTACCTATCCTATAGAGTGGATGAAGCAGAATCATGGAAAGAGCCTAGAGTGGATTGGAAATTTTCATCCTTACAATGATGATACTAAGTACAATGAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGAAAAATCCTCTAGCACAGTCTACTTGGAGCTCAGCCGATTAACATCTGATGACTCTGCTGTTTATTACTGTGCCAGGTTCAGCTGCAGCAGTCTGGGGCT...GAGCTAGTGAAGCCTGGAGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTC............ACTACCTATCCTATAGAGTGGATGAAGCAGAATCATGGAAAGAGCCTAGAGTGGATTGGAAATTTTCATCCTTAC......AATGATGATACTAAGTACAATGAAAAGTTCAAG...GGCAAGGCCACATTGACTGTAGAAAAATCCTCTAGCACAGTCTACTTGGAGCTCAGCCGATTAACATCTGATGACTCTGCTGTTTATTACTGTGC
IGHV-SVRH 12022-05-14watson_et_al:CAST_EiJ_IGHV1-28FCAST/EiJCAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTCACAAGCTACGATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTAGCGATGGTAGTACTAAGTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTACAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGGCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCAAGCAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACAAGCTACGATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTAGC......GATGGTAGTACTAAGTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTACAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGGCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCAAG
IGHV-TCPT 12022-05-14watson_et_al:CAST_EiJ_IGHV9-9FCAST/EiJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAACTGCTGGAATGCAGTGGGTGCAAAAGATGCCAGGAAAGGGTTTTAAGTGGATTGGCTGGATAAACACCCACTCTGGAGAGCCAAAATATGCAGAAGACTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTACAGATAAGCAACCTCAAAAACGAGGACACGGCTACGTATTTCTGTGCGAGACAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACAACTGCTGGAATGCAGTGGGTGCAAAAGATGCCAGGAAAGGGTTTTAAGTGGATTGGCTGGATAAACACCCAC......TCTGGAGAGCCAAAATATGCAGAAGACTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTACAGATAAGCAACCTCAAAAACGAGGACACGGCTACGTATTTCTGTGCGAGA
IGHV-TRDF 12022-05-14watson_et_al:CAST_EiJ_IGHV1-19FCAST/EiJCAGGTCCAGCTGCAGCAGTCTGGAGCTGAGTTGGTAAGGCCTGGGACTTCAGTGAAGGTGTCCTGCAAGGCTTCTGGATATGCCTTCACTAATTACTTGATAGAGTGGGTAAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAGTGATTAATCCTGGAAGTGGTGGTACTAACTACAATGAGAAGTTCAAGGGCAAGGCAACACTGACTGCAGACAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCAACAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGTTGGTAAGGCCTGGGACTTCAGTGAAGGTGTCCTGCAAGGCTTCTGGATATGCCTTC............ACTAATTACTTGATAGAGTGGGTAAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAGTGATTAATCCTGGA......AGTGGTGGTACTAACTACAATGAGAAGTTCAAG...GGCAAGGCAACACTGACTGCAGACAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCAA
IGHV-U6RV 12022-05-14watson_et_al:CAST_EiJ_IGHV6-5FCAST/EiJGAGGTGAAGCTGGATGAGTCTGGAGGAGGCTTGGTGCAACCTGGGAGGTCCATGAAACTCTCCTGTGTTGCCTCTGGATTCACTTTTAGTGACTACTGGATGAACTGGGTCCGCCAGTCTCCAGAGAAAGGACTGGAGTGGGTAGCACAAATTAGAAACAAACCTTATAATTATGAAACATATTATTCAGATTCTGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGAGCTGAAGACACGGGCATCTATTACTGTACGAGGTGAAGCTGGATGAGTCTGGAGGA...GGCTTGGTGCAACCTGGGAGGTCCATGAAACTCTCCTGTGTTGCCTCTGGATTCACTTTT............AGTGACTACTGGATGAACTGGGTCCGCCAGTCTCCAGAGAAAGGACTGGAGTGGGTAGCACAAATTAGAAACAAACCTTATAATTATGAAACATATTATTCAGATTCTGTGAAA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGAGCTGAAGACACGGGCATCTATTACTGTAC
IGHV-UBKV 12022-05-14watson_et_al:CAST_EiJ_IGHV5-6FCAST/EiJGAAGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTTACTTTCAGTAGCTATGACATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAGTGGTGGTAGTTACACCTACTATCCAGACAGTGTGAAGGGGCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTTTGAAGTCTGAGGACACAGCCATGTATTACTGTGCGAAGTGAAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTTACTTTC............AGTAGCTATGACATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAGTGGT......GGTAGTTACACCTACTATCCAGACAGTGTGAAG...GGGCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTTTGAAGTCTGAGGACACAGCCATGTATTACTGTGC
IGHV-UD3M 12022-05-14watson_et_al:CAST_EiJ_IGHV3-6FCAST/EiJGATGTGCAGCTTCAGGAGTCAGGACCTGGCCTGGTGAAACCTTCTCAGTCACTTTCCCTCACCTGCACTGTCACTGGCTACTCCATCACCAGTGGTTATGACTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGTGGTAGCACTAACTACAACCCATCCCTCAAAAGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTTCCTGCAGTTGAATTCTGTGATTACTGAGGACACAGCCACATATTACTGTGCGATGTGCAGCTTCAGGAGTCAGGACCT...GGCCTGGTGAAACCTTCTCAGTCACTTTCCCTCACCTGCACTGTCACTGGCTACTCCATCACC.........AGTGGTTATGACTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGT.........GGTAGCACTAACTACAACCCATCCCTCAAA...AGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTTCCTGCAGTTGAATTCTGTGATTACTGAGGACACAGCCACATATTACTGTGC
IGHV-UFPS 12022-05-14watson_et_al:CAST_EiJ_IGHV4-1FCAST/EiJGAGGTGAAGCTTCTCGAGTCTGGAGGTGGCCTGGTGCAGCCTGGAGGATCCCTGAAACTCTCCTGTGCAGCCTCAGGATTCGATTTTAGTAGATACTGGATGAGTTGGGTCCGGCAGGCTCCAGGGAAAGGGCTAGAATGGATTGGAGAAATTAATCCAGGTAGCAGTACGATAAACTATGCACCATCTCTAAAGGATAAATTCATCATCTCCAGAGACAATGCCAAAAATACGCTGTACCTGCAAATGAGCAAAGTGAGATCTGAGGACACAGCCCTTTATTACTGTGGAGGTGAAGCTTCTCGAGTCTGGAGGT...GGCCTGGTGCAGCCTGGAGGATCCCTGAAACTCTCCTGTGCAGCCTCAGGATTCGATTTT............AGTAGATACTGGATGAGTTGGGTCCGGCAGGCTCCAGGGAAAGGGCTAGAATGGATTGGAGAAATTAATCCAGGT......AGCAGTACGATAAACTATGCACCATCTCTAAAG...GATAAATTCATCATCTCCAGAGACAATGCCAAAAATACGCTGTACCTGCAAATGAGCAAAGTGAGATCTGAGGACACAGCCCTTTATTACTGTG
IGHV-UULO 12022-05-14watson_et_al:CAST_EiJ_IGHV2-2FCAST/EiJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCTGGGTTCTCATTAACCAGCTATGATATAAGCTGGGTTCGCCAGCCACCGGGAAAGGGTCTGGAGTGGATGGGAGTAATATGGGCTGATGGAAGCACAAATTATAATTCAGCTCTCATGTCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCAGGTACTACTGTGCCAGCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCTGGGTTCTCATTA............ACCAGCTATGATATAAGCTGGGTTCGCCAGCCACCGGGAAAGGGTCTGGAGTGGATGGGAGTAATATGGGCTGAT.........GGAAGCACAAATTATAATTCAGCTCTCATG...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCAGGTACTACTGTGCCAG
IGHV-VL52 12022-05-14watson_et_al:CAST_EiJ_IGHV1-23FCAST/EiJAAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTGAAACCCGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACTGAGTATATTATACACTGGGTAAAGCAGAGGTCTGGACAGGGTCTTGAGTGGATTGGGTGGTTTTACCCTGGAAGTGGTAGTATAAAGTACAATGAGAAATTCAAGGACAAGGCCACATTGACTGCGGACAAATCCTCCAGCACAGTCTATATGGAGCTTAGTAGATTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGACACGAAGAAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTGAAACCCGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACTGAGTATATTATACACTGGGTAAAGCAGAGGTCTGGACAGGGTCTTGAGTGGATTGGGTGGTTTTACCCTGGA......AGTGGTAGTATAAAGTACAATGAGAAATTCAAG...GACAAGGCCACATTGACTGCGGACAAATCCTCCAGCACAGTCTATATGGAGCTTAGTAGATTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGACACGAAG
IGHV-VTEX 12022-05-14watson_et_al:CAST_EiJ_IGHV1-17FCAST/EiJGAGGTTCAGCTCCAGCAGTCTGGGACTGTGCTGGCAAGGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTTACCAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGCGCTATTTATCCTGGAAATAGTGATACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCAAACTGACTGCAGTCACATCCACCAGCACTGCCTACATGGAGCTCAGCAGCCTGACAAATGAGGACTCTGCGGTCTATTACTGTACGAGGTTCAGCTCCAGCAGTCTGGGACT...GTGCTGGCAAGGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTT............ACCAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGCGCTATTTATCCTGGA......AATAGTGATACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCAAACTGACTGCAGTCACATCCACCAGCACTGCCTACATGGAGCTCAGCAGCCTGACAAATGAGGACTCTGCGGTCTATTACTGTAC
IGHV-WQ2B 12022-05-14watson_et_al:CAST_EiJ_IGHV1-6FCAST/EiJGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTCACTGACTACAACATGCACTGGGTGAAGCAGAGCCGTGGAAAGAGCCTTGAGTGGATTGGAGGTATTAATCCTAACAATGGTGGTACTGGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTAACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGATTCTGCAGTCTATTACTGTGCAAGGAGGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACAACATGCACTGGGTGAAGCAGAGCCGTGGAAAGAGCCTTGAGTGGATTGGAGGTATTAATCCTAAC......AATGGTGGTACTGGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTAACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGATTCTGCAGTCTATTACTGTGCAAG
IGHV-WVEQ 12022-05-14watson_et_al:CAST_EiJ_IGHV1-34FCAST/EiJGAAGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTGACTATGTTATGCACTGGGTGAAGCAGATCAATGGAAAGAGCCTTGAGTGGATTGGATATATTAATCCTTATAATGATTATACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGAAGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTC............ACTGACTATGTTATGCACTGGGTGAAGCAGATCAATGGAAAGAGCCTTGAGTGGATTGGATATATTAATCCTTAT......AATGATTATACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGT
IGHV-Y5MV 12022-05-14watson_et_al:CAST_EiJ_IGHV1-29FCAST/EiJCAGGTTCAGCTGCAGCAGTCTGGAGCTGAGCTGATGAAGCCTGGGGCCTCAGTGAAGCTTTCCTGCAAGGCTACTGGCTACACATTCACTGGCTACTGGATAGAGTGGGTAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGAGATTTTACCTGGAAGTGGTAGTACTAACTACAATGAGAAGTTCAAGGGCAAGGCCACATTCACTGCAGATACATCCTCCAACACAGCCTACATGCAACTCAGCAGCCTGACAACTGAGGACTCTGCCGTCTATTACTGTCAGGTTCAGCTGCAGCAGTCTGGAGCT...GAGCTGATGAAGCCTGGGGCCTCAGTGAAGCTTTCCTGCAAGGCTACTGGCTACACATTC............ACTGGCTACTGGATAGAGTGGGTAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGAGATTTTACCTGGA......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...GGCAAGGCCACATTCACTGCAGATACATCCTCCAACACAGCCTACATGCAACTCAGCAGCCTGACAACTGAGGACTCTGCCGTCTATTACTGT
IGHV-YUW4 12022-05-14watson_et_al:CAST_EiJ_IGHV14-3FCAST/EiJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAGACAGCTTTATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATATGCCCCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTTAGCAGCCTGACATCTGAGGACACTGCTGTCTATTACTGTGGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAGACAGCTTTATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAG......GATGGTGAAACTAAATATGCCCCGAAGTTCCAG...GGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTTAGCAGCCTGACATCTGAGGACACTGCTGTCTATTACTGTG
IGHV-Z54E 12022-05-14watson_et_al:CAST_EiJ_IGHV1-32FCAST/EiJGAGGTCCAGCTTCAGCAGTCTGGAGCTGAGCTGGTGAGGGCTGGGTCCTCAGTGAAGCTGTCCTGCAAGACTTCTGGATATACATTCACAAGCTATGGTATAAACTGGGTGAAACAGAGGCCTGGACAGGGCCTGGAATGGATTGGATATATTTATCCTGGAAATGGTTATACTGAGTACAATGAGAAGTTCCAGGGCCAGGCCACACTGACTTCAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGAAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCGAGGTCCAGCTTCAGCAGTCTGGAGCT...GAGCTGGTGAGGGCTGGGTCCTCAGTGAAGCTGTCCTGCAAGACTTCTGGATATACATTC............ACAAGCTATGGTATAAACTGGGTGAAACAGAGGCCTGGACAGGGCCTGGAATGGATTGGATATATTTATCCTGGA......AATGGTTATACTGAGTACAATGAGAAGTTCCAG...GGCCAGGCCACACTGACTTCAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGAAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGC

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

History

History logs the times and reasons for the publication of each version of this germline set. Key changes are noted. For detailed changes, click on the link to the sequence.

William Lees
2022-05-13 16:42:45
Mouse germline set G00049 (CAST/EiJ IGHV) created

Mouse germline set G00049 (CAST/EiJ IGHV) created

William Lees
2022-05-14 14:45:35
Version 1 published

First release

Versions

All published versions of this germline set.

Set NameSpeciesSpecies subgroupLocusRelease VersionRelease Date
CAST/EiJ IGHMouseCAST/EiJIGH12022-05-14