Details

SpeciesHomo sapiens
Species subgroup
Subgroup type
Sequence NameIGHV3-43D*05
IUIS NameIGHV3-43D*05
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeUnrearranged and rearranged
MappedTrue
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEndCoding SequenceSC Coding Sequence
OW151136InferredGenBank1297
SRX19354822VGenbank1497

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start236
CDR1 End259
CDR2 Start311
CDR2 End334
CDR3 Start449

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGAGTTTGGACTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAG
L-PART2 Start150
L-PART2 End160
L_PART2GTGTCCAGTGT
v_rs_start459
v_rs_end497
V_HEPTAMERCACAGTG
V_NONAMERACAAAAACC
Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02558
CuratorWilliam Lees
Curator addressClareo Biosciences, Louisville, Kentucky, USA
Version4
Release Date2026-05-27
Release Notes

Repeat – had to roll back yesterday’s changes.

Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names

LocusIGH
Sequence TypeV
Gene Subgroup3
Gene Designation43D
Allele Designation05
Gene start161
Gene end458

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

This inferred allele was assessed at IARC meeting 100 on June 8th, 2022. IGHV3-43D*04_G4A was inferred in subject S10 (VDJ-base: P1_I10_S1). The genotype also carried IGHV3-43*01 but no other allele of IGHV3-43D. The inference was supported by a relatively small number of sequences (104) and unmutated sequences (93), a low overall frequency in the unmutated population (0.3%) and a small but diverse set of unique CDR3s (89) in the unmutated sequence set. Its allelic ratio was 100%. Haplotyping based on allelic diversity in IGHJ6 was possible and the alleles distributed to one haplotype, a haplotype different from that associated with the allele IGHV3-43 (IGHV3-43D*04_G4A: 100:0; IGHV3-43*01: 0:100). Reads of IGHV3-43D*04_G4A were associated to the same haplotype as those of IGHV4-38-2, a common duplication combination. Reads of IGHV3-43D*04_G4A were associated to an upstream region similar to that of other alleles of IGHV3-43D (but not similar to alleles of IGHV3-43) (doi: 10.3389/fimmu.2021.730105). Altogether, the association of this allele to IGHV3-43D is reasonable. IARC affirms the sequence at level 1 up to and including base 321 in agreement with past practice. It is acknowledged that the allele most likely carries one additional base, typically A at base position 322. A trailing “.” indicates IARC’s opinion that the sequence is likely to contain one additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. The allele is given the name IGHV3-43D*i02.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample OW151136
VDJbase example haplotype: Y
Mapped by IARC haplotype

TR-IG NRC Report (2023-1a) allocated the IUIS name IGHV3-43D*05 to this allele

The report stated:

The TR-IG NRC have determined that the IARC-affirmed inferred sequence IGHV3-43D*i02 should be confirmed as IGHV3-43D*05. The missing terminal nucleotide of the sequence can be confirmed as ‘A’ by reference to recent genomic sequences of Rodriguez and colleagues that are reported in the VDJbase database from three individuals. This evidence is accessible via the VDJbase genomic data gene table (https://vdjbase.org/genetable ). The location of the sequence was well described in the IARC report, and is demonstrated by good haplotypable AIRR-seq data. Data strongly suggests that the novel allele is at the IGHV3-43D locus rather than the IGHV3-43 locus, and IGHV3-43 and IGHV3-43D are at least 22 nucleotides different from other IGHV genes.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Annotation is based on VDJbase record P25_I127_S1 for sample W-61 (Genbank: SRX19354822).

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2022-07-25 10:53:31
Version 1 published

The allele was published by IARC on July 25th, 2022.

William Lees
2023-07-10 11:24:39
Version 2 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2024-01-11 09:58:38
Version 3 published

First published version.

William Lees
2026-05-27 07:52:07
Version 4 published

Repeat – had to roll back yesterday’s changes.

Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names

Changes from previous version

v3v4
Curator addressBirkbeck College, University of London, Malet Street, LondonClareo Biosciences, Louisville, Kentucky, USA
Alternative namesIGHV3-43D*i02
Inference TypeRearranged OnlyUnrearranged and rearranged
Subgroup typenone
Allele Designationi0205
Full Sequence
Gene start1161
Gene end298458
L-PART1 Start1
L-PART1 End46
L-PART2 Start150
L-PART2 End160
CDR1 Start76236
CDR1 End99259
CDR2 Start151311
CDR2 End174334
CDR3 Start289449
v_rs_start459
v_rs_end497
3' Extension
5' Extension
curational_tagslikely_full-lengthlikely_full_length
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIUIS NameVersionDate
IGHV3-43D*i0212022-07-25
IGHV3-43D*i0222023-07-10
IGHV3-43D*05IGHV3-43D*0532024-01-11
IGHV3-43D*05IGHV3-43D*0542026-05-27