| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGHV3-43D*05 |
| IUIS Name | IGHV3-43D*05 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged and rearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| OW151136 | Inferred | GenBank | 1 | 297 | ||
| SRX19354822 | V | Genbank | 1 | 497 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 236 |
| CDR1 End | 259 |
| CDR2 Start | 311 |
| CDR2 End | 334 |
| CDR3 Start | 449 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGAGTTTGGACTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAG |
| L-PART2 Start | 150 |
| L-PART2 End | 160 |
| L_PART2 | GTGTCCAGTGT |
| v_rs_start | 459 |
| v_rs_end | 497 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACAAAAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A02558 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 4 |
| Release Date | 2026-05-27 |
| Release Notes | Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 3 |
| Gene Designation | 43D |
| Allele Designation | 05 |
| Gene start | 161 |
| Gene end | 458 |
Notes are added by IARC reviewers.
| This inferred allele was assessed at IARC meeting 100 on June 8th, 2022. IGHV3-43D*04_G4A was inferred in subject S10 (VDJ-base: P1_I10_S1). The genotype also carried IGHV3-43*01 but no other allele of IGHV3-43D. The inference was supported by a relatively small number of sequences (104) and unmutated sequences (93), a low overall frequency in the unmutated population (0.3%) and a small but diverse set of unique CDR3s (89) in the unmutated sequence set. Its allelic ratio was 100%. Haplotyping based on allelic diversity in IGHJ6 was possible and the alleles distributed to one haplotype, a haplotype different from that associated with the allele IGHV3-43 (IGHV3-43D*04_G4A: 100:0; IGHV3-43*01: 0:100). Reads of IGHV3-43D*04_G4A were associated to the same haplotype as those of IGHV4-38-2, a common duplication combination. Reads of IGHV3-43D*04_G4A were associated to an upstream region similar to that of other alleles of IGHV3-43D (but not similar to alleles of IGHV3-43) (doi: 10.3389/fimmu.2021.730105). Altogether, the association of this allele to IGHV3-43D is reasonable. IARC affirms the sequence at level 1 up to and including base 321 in agreement with past practice. It is acknowledged that the allele most likely carries one additional base, typically A at base position 322. A trailing “.” indicates IARC’s opinion that the sequence is likely to contain one additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. The allele is given the name IGHV3-43D*i02. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: TR-IG NRC Report (2023-1a) allocated the IUIS name IGHV3-43D*05 to this allele The report stated: The TR-IG NRC have determined that the IARC-affirmed inferred sequence IGHV3-43D*i02 should be confirmed as IGHV3-43D*05. The missing terminal nucleotide of the sequence can be confirmed as ‘A’ by reference to recent genomic sequences of Rodriguez and colleagues that are reported in the VDJbase database from three individuals. This evidence is accessible via the VDJbase genomic data gene table (https://vdjbase.org/genetable ). The location of the sequence was well described in the IARC report, and is demonstrated by good haplotypable AIRR-seq data. Data strongly suggests that the novel allele is at the IGHV3-43D locus rather than the IGHV3-43 locus, and IGHV3-43 and IGHV3-43D are at least 22 nucleotides different from other IGHV genes. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| Mats Ohlin 2022-07-25 10:53:31 | Version 1 published The allele was published by IARC on July 25th, 2022. |
| William Lees 2023-07-10 11:24:39 | Version 2 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2024-01-11 09:58:38 | Version 3 published First published version. |
| William Lees 2026-05-27 07:52:07 | Version 4 published Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| v3 | v4 | |
|---|---|---|
| Curator address | Birkbeck College, University of London, Malet Street, London | Clareo Biosciences, Louisville, Kentucky, USA |
| Alternative names | IGHV3-43D*i02 | |
| Inference Type | Rearranged Only | Unrearranged and rearranged |
| Subgroup type | none | |
| Allele Designation | i02 | 05 |
| Full Sequence | ||
| Gene start | 1 | 161 |
| Gene end | 298 | 458 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 150 | |
| L-PART2 End | 160 | |
| CDR1 Start | 76 | 236 |
| CDR1 End | 99 | 259 |
| CDR2 Start | 151 | 311 |
| CDR2 End | 174 | 334 |
| CDR3 Start | 289 | 449 |
| v_rs_start | 459 | |
| v_rs_end | 497 | |
| 3' Extension | ||
| 5' Extension | ||
| curational_tags | likely_full-length | likely_full_length |
| Notes | changed |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGHV3-43D*i02 | 1 | 2022-07-25 | |
| IGHV3-43D*i02 | 2 | 2023-07-10 | |
| IGHV3-43D*05 | IGHV3-43D*05 | 3 | 2024-01-11 |
| IGHV3-43D*05 | IGHV3-43D*05 | 4 | 2026-05-27 |