Sequence IGHV1-69*i04
Details
| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGHV1-69*i04 |
| IUIS Name | IGHV1-69*i04 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged and rearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Evidence
The table below lists submissions to IARC , and the inferences within them, on which this IARC-affirmed sequence is based.
'Sequence Match' indicates whether the inference exactly matches the sequence, and clicking on the tick or cross will provide an alignment. Mismatches may be caused, for example, by the inclusion of leader sequences, or nucleotides in the inference which do not in IARC's opinion have sufficient evidence for inclusion in the sequence.
| Submission ID | Accession No | Subject ID | Genotype Name | Sequence Name | Sequence Match |
|---|---|---|---|---|---|
| S00037 | OW151137 | S45 | P1_I48_S1_ogrdb_report | IGHV1-69*06_G240A |
Un-rearranged Observations
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| SRX19355444 | V | Genbank | 1 | 478 |
Observations in AIRR-seq Repertoires
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR delineation
| CDR1 Start | 219 |
| CDR1 End | 242 |
| CDR2 Start | 294 |
| CDR2 End | 317 |
| CDR3 Start | 432 |
Non-Core Regions
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGACTGGACCTGGAGGTTCCTCTTTGTGGTGGCAGCAGCTACAG |
| L-PART2 Start | 133 |
| L-PART2 End | 143 |
| L_PART2 | GTGTCCAGTCC |
| v_rs_start | 440 |
| v_rs_end | 478 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | TCAGAAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
Extension
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
Additional Information
| Sequence ID | A02559 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 4 |
| Release Date | 2026-05-27 |
| Release Notes | Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 1 |
| Gene Designation | 69 |
| Allele Designation | i04 |
| Gene start | 144 |
| Gene end | 439 |
Notes
Notes are added by IARC reviewers.
| This inferred allele was assessed at IARC meeting 100 on June 8th, 2022. IGHV1-69*06_G240A was inferred in subject S45 (VDJ-base: P1_I48_S1). The genotype also carried IGHV1-69*01 and IGHV1-69*06. Given the common duplication of IGHV1-69 in the human IGHV locus, this is not an unexpected finding. The inference was supported by a relative large number of sequences (680) and unmutated sequences (627), a high overall frequency in the unmutated population (2.4%) and a large and diverse set of unique CDR3s (607) in the unmutated sequence set. Its allelic ratio was 22%. Haplotyping based on allelic diversity in IGHJ6 was not possible. IARC affirms the sequence at level 1 up to and including base 319 in agreement with past practice. It is acknowledged that the allele most likely carries one additional base, typically A at base position 320. A trailing “.” indicates IARC’s opinion that the sequence is likely to contain one additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. The allele is given the name IGHV1-69(D)*i04. This name highlights the uncertainty of which of the two duplicated genes the allele is most likely associated with. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
Attachments
History
History logs the times and reasons for the publication of each version of this sequence.
| Mats Ohlin 2022-07-25 10:52:55 | Version 1 published The allele was published by IARC on July 25th, 2022. |
| William Lees 2023-07-10 11:20:54 | Version 2 published (D) removed from name as this designation is not used in the AIRR-C human germline sets |
| William Lees 2023-07-10 11:24:36 | Version 3 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2026-05-27 07:52:06 | Version 4 published Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
Changes from previous version
| v3 | v4 | |
|---|---|---|
| Curator address | Birkbeck College, University of London, Malet Street, London | Clareo Biosciences, Louisville, Kentucky, USA |
| IUIS Name | IGHV1-69*i04 | |
| Mapped | False | True |
| Inference Type | Rearranged Only | Unrearranged and rearranged |
| Full Sequence | ||
| Coding Sequence | ||
| Gene start | 1 | 144 |
| Gene end | 295 | 439 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 133 | |
| L-PART2 End | 143 | |
| CDR1 Start | 76 | 219 |
| CDR1 End | 99 | 242 |
| CDR2 Start | 151 | 294 |
| CDR2 End | 174 | 317 |
| CDR3 Start | 289 | 432 |
| v_rs_start | 440 | |
| v_rs_end | 478 | |
| Extension? | True | False |
| 3' Extension | A | |
| curational_tags | likely_truncated | likely_full_length |
| Notes | changed |
Versions
All published versions of this sequence.
| Sequence Name | IMGT Name | Version | Date |
|---|---|---|---|
| IGHV1-69*i04 | 2 | 2023-07-10 | |
| IGHV1-69*i04 | 3 | 2023-07-10 | |
| IGHV1-69*i04 | IGHV1-69*i04 | 4 | 2026-05-27 |