IARC meeting 63, Nov 20th, 2020:
The meeting considered the inference of the variant IGHV4-61*02_a234g, in the VDJbase dataset of sample P1_I86_S1. The sequence was seen in ten samples, including 4 P1 samples. The meeting focused on sample P1_I86_S1, in which the inferences was seen in 1.82% of all unmutated rearrangements, with 592 sequences including 519 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV4-61*01 was also present in the genotype, at a lower frequency (0.38% of all unmutated sequences, 116 sequences, 107 unmutated sequences). Haplotyping data showed perfect separation of the assigned alleles. Plots of the final 3’ nucleotides of the inference were unavailable. The inferred sequence was tentatively affirmed as a Level 1 sequence. The final 3’ nucleotides will be considered at a later date, at which time the affirmed sequence will be noted in the IARC minutes.

IARC meeting 84, Oct 25th, 2021:
IGHV4-61*02_A234G was inferred in subject S82 (P1_I86_S1; ERR2567259). This inference has previously been pre-assessed at IARC meeting 63 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-63-24_11_20-minutes.pdf). The inference was supported by many sequences (613) and unmutated sequences (530) a high allelic frequency (84%), a high overall frequency in the unmutated population (2.2%) and many unique CDR3s (528) in the unmutated sequence set. The related gene set IGHV4-4, IGHV4-59 and IGHV4-61 were represented by the following inferred alleles IGHV4-4*07 (haplotyping ratio: 2:98), IGHV4-59*01 (haplotyping ratio: 36:64), IGHV4-61*01 (haplotyping ratio 100:0), and IGHV4-61*02_A234G (haplotyping ratio: 0:100). In a separate study it has been proposed that the IGHJ6*02-related haplotype in this subject was occupied by poorly expressed allele IGHV4-4*01 (DOI: 10.3389/fimmu.2020.603980). IGHV4-61*02_A234G was found to be expressed at higher frequency than the poorly expressed allele IGHV4-61*01 (528 vs 107 unique CDR3s in the unmutated sequence set). Overall expression levels, diversity and haplotyping strongly supports the inference. In addition, the upstream region of IGHV4-61*02_A234G (DOI: 10.3389/fimmu.2021.730105) in this subject is different from that of the other alleles of these three genes that are present in this subject (including the previously published upstream region of IGHV4-4*01).

It has been noted that IGHV4-61*02_A234G was also found in subject S39 (P1_I42_S1; ERR2567216) used to assess the inference of IGHV4-4*i03 (although this data set was not submitted to IARC for assessment of IGHV4-61*02_A234G). In this sample, IGHV4-61*02_A234G was supported by many sequences (476) and unmutated sequences (395), a high overall frequency in the unmutated population (2.4%) and many unique CDR3s (390) in the unmutated sequence set. No other allele named as IGHV4-61 had been inferred in this subject but IGHV4-59*08, an allele suspected to residue in gene IGHV4-61 (DOI: 10.1038/ncomms14946), was found. The allelic ratio of IGHV4-61*02_A234G in this context would be 61%. Haplotyping of this subject was possible based on an allele of IGHD3-10 (10.3389/fimmu.2019.00987) not documented by the IMGT database. In this context, the two alleles of the genotype believed to be associated to IGHV4-61, IGHV4-61*02_A234G and IGHV4-59*08, showed excellent separation (see also documentation associated to the affirmation of IGHV4-4*i03).

IARC, taking all of the collective evidence under consideration, affirms the sequence at level 1 up to and including base 319 in agreement with past practice. It is acknowledged that the allele most likely carries one additional base, typically A at base position 320. Although there is nothing in the data, including haplotype assessment, that suggest that the allele does not reside in gene IGHV4-61, it must be recognised, in particular in view of the similarity of alleles linked to IGHV4-4/IGHV4-59/IGHV4-61, that IARC gene naming does not reflect an absolute position on the precise location of the allele to a specific gene. The allele is given the name IGHV4-61*i03.

>IGHV4-61*i03
CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCGCCGGGAAGGGACTGGAGTGGATTGGGCGTATCTATACCAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGAG.