IARC meeting 63, Nov 24th, 2020:
The meeting considered the inference of the variant IGHV4-39*07_c288a in the VDJbase datasets of sample P1_I29_S1. (It was present in two other VDJbase samples). The sequence was seen in 4.61% of all unmutated rearrangements, with 1201 sequences including 1068 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV4-39*01 was also present in the genotype, at a similar frequency (4.35% of all unmutated sequences, 1135 sequences, 1009 unmutated sequences). Plots of the final 3’ nucleotides were unavailable. Haplotyping data strongly supported the inference. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes.

IARC-meeting 84, Oct 25th, 2021:
IGHV4-39*07_C288A was inferred in subject S29 (VDJ-base: P1_I29_S1). This inference has previously been pre-assessed at IARC meeting 63 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-63-24_11_20-minutes.pdf). The genotype also carried IGHV4-39*01. The inference was supported by many sequences (1304) and unmutated sequences (1107) a balanced allelic frequency (52%), a high overall frequency in the unmutated population (5.7%) and many unique CDR3s (1086) in the unmutated sequence set. Haplotyping based on allelic diversity in IGHJ6 was possible and the alleles distributed well between haplotypes (IGHV4-39*07_C288A: 99:1; IGHV4-39*01: 0:100). IARC infers the sequence at level 1 up to and including base 319 in agreement with past practice. It is acknowledged that the allele most likely carry one additional base, typically A at base position 320. The allele is given the name IGHV4-39*i02.

>IGHV4-39*i02 (IGHV4-39*07_C288A)
CAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCAGCGGACACGGCCGTGTATTACTGTGCGAGAG.