Details


Species	Human
Species subgroup
Subgroup type	none
Sequence Name	IGHV4-39*i02
IUIS Name	IGHV4-39*09
Alternative names
Affirmation Level	1
Full Sequence
Coding Sequence
Functionality	F
Inference Type	Rearranged Only
Alternative names
Paralogs

Evidence

The table below lists the submissions, and the inferences within them, on which this published sequence is based. The list may be short when the sequence is first published, containing, for example, reference to just a single submission, but is expected to grow over time as additional inferences are submitted.

'Sequence Match' indicates whether the inference exactly matches the sequence, and clicking on the tick or cross will provide an alignment. Mismatches may be caused, for example, by the inclusion of leader sequences, or nucleotides in the inference which do not in IARC's opinion have sufficient evidence for inclusion in the sequence.

Submission ID	Accession No	Subject ID	Genotype Name	Sequence Name	Sequence Match
S00031	OU596103	S29	P1_I29_S1	IGHV4-39*07_C288A

Supporting Observations

Sequences in other published genotypes which have been identified by IARC and support the inference:

No Items

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele Name	Subjects	Sequence Match
IGHV4-39*07_c288a	4

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

Additional Information


Sequence ID	A00071
Curator address	Dept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version	1
Release Date	2021-11-01
Release Notes	Submission published by IARC on November 1st, 2021
Locus	IGH
Sequence Type	V
Gene Subgroup	4
Gene Designation	39
Allele Designation	i02

Acknowledgements

Individuals acknowledged as contributing to this sequence:

Name	Institution	ORCID ID
William Lees	Birkbeck College, University of London, Malet Street, London
Ayelet Peres	Bar-Ilan University, Ramat-Gan, Israel
Gur Yaari	Bar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.


IARC meeting 63, Nov 24th, 2020: The meeting considered the inference of the variant IGHV4-3907_c288a in the VDJbase datasets of sample P1_I29_S1. (It was present in two other VDJbase samples). The sequence was seen in 4.61% of all unmutated rearrangements, with 1201 sequences including 1068 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV4-3901 was also present in the genotype, at a similar frequency (4.35% of all unmutated sequences, 1135 sequences, 1009 unmutated sequences). Plots of the final 3’ nucleotides were unavailable. Haplotyping data strongly supported the inference. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes. IARC-meeting 84, Oct 25th, 2021: IGHV4-3907_C288A was inferred in subject S29 (VDJ-base: P1_I29_S1). This inference has previously been pre-assessed at IARC meeting 63 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-63-24_11_20-minutes.pdf). The genotype also carried IGHV4-3901. The inference was supported by many sequences (1304) and unmutated sequences (1107) a balanced allelic frequency (52%), a high overall frequency in the unmutated population (5.7%) and many unique CDR3s (1086) in the unmutated sequence set. Haplotyping based on allelic diversity in IGHJ6 was possible and the alleles distributed well between haplotypes (IGHV4-3907_C288A: 99:1; IGHV4-3901: 0:100). IARC infers the sequence at level 1 up to and including base 319 in agreement with past practice. It is acknowledged that the allele most likely carry one additional base, typically A at base position 320. The allele is given the name IGHV4-39i02. >IGHV4-39i02 (IGHV4-39*07_C288A) CAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCAGCGGACACGGCCGTGTATTACTGTGCGAGAG.

IARC meeting 63, Nov 24th, 2020:
The meeting considered the inference of the variant IGHV4-39*07_c288a in the VDJbase datasets of sample P1_I29_S1. (It was present in two other VDJbase samples). The sequence was seen in 4.61% of all unmutated rearrangements, with 1201 sequences including 1068 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV4-39*01 was also present in the genotype, at a similar frequency (4.35% of all unmutated sequences, 1135 sequences, 1009 unmutated sequences). Plots of the final 3’ nucleotides were unavailable. Haplotyping data strongly supported the inference. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes.

IARC-meeting 84, Oct 25th, 2021:
IGHV4-39*07_C288A was inferred in subject S29 (VDJ-base: P1_I29_S1). This inference has previously been pre-assessed at IARC meeting 63 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-63-24_11_20-minutes.pdf). The genotype also carried IGHV4-39*01. The inference was supported by many sequences (1304) and unmutated sequences (1107) a balanced allelic frequency (52%), a high overall frequency in the unmutated population (5.7%) and many unique CDR3s (1086) in the unmutated sequence set. Haplotyping based on allelic diversity in IGHJ6 was possible and the alleles distributed well between haplotypes (IGHV4-39*07_C288A: 99:1; IGHV4-39*01: 0:100). IARC infers the sequence at level 1 up to and including base 319 in agreement with past practice. It is acknowledged that the allele most likely carry one additional base, typically A at base position 320. The allele is given the name IGHV4-39*i02.

>IGHV4-39*i02 (IGHV4-39*07_C288A)
CAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCAGCGGACACGGCCGTGTATTACTGTGCGAGAG.

Attachments

	Supplementary Files

History

History logs the times and reasons for the publication of each version of this sequence.


Mats Ohlin 2021-11-01 22:50:46	Version 1 published Submission published by IARC on November 1st, 2021


Mats Ohlin 2021-11-17 15:25:43	*IMGT Name updated to IGHV4-3909** IMGT Name updated.

Versions

All published versions of this sequence.

Sequence Name	IMGT Name	Alternative names	Inference Type	Affirmation Level	Species subgroup	Subgroup type	Version	Date
IGHV4-39*i02	IGHV4-39*09		Rearranged Only	1		none	1	2021-11-01