Details

SpeciesHomo sapiens
Species subgroup
Subgroup typenone
Sequence NameIGHV4-39*i01
IUIS NameIGHV4-39*08
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityF
Inference TypeRearranged Only
Mapped
Paralogs
Paralog Rep

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start76
CDR1 End105
CDR2 Start157
CDR2 End177
CDR3 Start292

Non-Core Regions

Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Additional Information

Sequence IDA00070
CuratorMats Ohlin
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version1
Release Date2021-11-01
Release Notes

Submission published by IARC on November 1st, 2021

LocusIGH
Sequence TypeV
Gene Subgroup4
Gene Designation39
Allele Designationi01
Gene start1
Gene end298

Acknowledgements

Individuals acknowledged as contributing to this sequence:

NameInstitutionORCID ID
William LeesBirkbeck College, University of London, Malet Street, London
Ayelet PeresBar-Ilan University, Ramat-Gan, Israel
Gur YaariBar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.

IARC meeting 62 (Nov 3rd, 2020):
The meeting considered the inference of the variant IGHV4-39*01_c66g, in the VDJbase dataset of sample P1_I90_S1. The sequence was seen in 2.74% of all unmutated rearrangements, with 1217 sequences including 1098 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV4-39*01 was also present in the genotype, at a similar frequency (3.09% of all unmutated sequences,
1360 sequences, 1239 unmutated sequences). Haplotyping data showed almost perfect separation of the assigned alleles. Plots of the final 3’ nucleotides of the inference were unavailable. The inferred sequence was tentatively affirmed as a Level 1 sequence. The final 3’ nucleotides will be considered at a later date, at which time the affirmed sequence will be noted in the IARC minutes.

IARC meeting 83 (Oct 18th, 2021):
IGHV4-39*01_C66G was inferred in subject S86 (VDJbase: P1_I90_S1), a genotype that also carries IGHV4-39*01. This inference has previously been pre-assessed at IARC meeting 62 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2021/04/Meeting-62-3_11_20-minutes.pdf). IGHV4-39*01_C66G was well expressed, represented by 1305 sequences, 1135 unmutated sequences, 1131 unique CDR3s in the unmutated sequence set, showed an allelic frequency of 48%, and represented 3.3% of all unmutated reads of the genotype. Haplotyping based on allelic diversity in IGHJ6 was possible and the alleles distributed well between haplotypes (IGHV4-39*01_C66G: 2:98; IGHV4-39*01: 100:0). IARC affirms the sequence as a level 1 sequence up to and including base 319 in agreement with past practice. It is acknowledged that the allele most likely carries one additional base, typically A at base position 320. A trailing “.” indicates IARC’s opinion that the sequence is likely to contain an additional 3’ nucleotide for which there is insufficient evidence to make an affirmation. It is known that the second last base of alleles of IGHV4-39 may be either C or G. The data describing the final bases of this inferred allele strongly supports that this base (319) is a C. The inference of IGHV4-39*07_C288A in data set VDJbase: P1_I29_S1 in contrast suggests that this allele features a G as the penultimate residue, illustrating that the inference process can pick up a difference at the second last base of alleles. The allele representing IGHV4-39*01_C66G is given the name IGHV4-39*i01.

>IGHV4-39*i01
CAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACGTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCTGTGTATTACTGTGCGAGAC.

Attachments

Attachment File Name
 
 IGHV4−39*01_C66G P1_I90_S1.png
 IGHV4−39*07_C288A P1_I29_S1.png

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2021-11-01 22:50:18
Version 1 published

Submission published by IARC on November 1st, 2021

Mats Ohlin
2021-11-17 15:25:25
IMGT Name updated to IGHV4-39*08

IMGT Name updated.

Versions

All published versions of this sequence.

Sequence NameIMGT NameVersionDate
IGHV4-39*i01IGHV4-39*0812021-11-01
IGHV4-39*08IGHV4-39*0822023-07-10