Details


Species	Human
Species subgroup
Subgroup type	none
Sequence Name	IGHV3-9*i01
IUIS Name	IGHV3-9*04
Alternative names
Affirmation Level	1
Full Sequence
Coding Sequence
Functionality	F
Inference Type	Rearranged Only
Mapped
Paralogs
Paralog Rep

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele Name	Subjects	Sequence Match
IGHV3-9*01_t307c	1

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

CDR delineation


CDR1 Start	76
CDR1 End	99
CDR2 Start	151
CDR2 End	174
CDR3 Start	289

Additional Information


Sequence ID	A00069
Curator	Mats Ohlin
Curator address	Dept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version	1
Release Date	2021-11-01
Release Notes	Submission published by IARC on November 1st, 2021
Locus	IGH
Sequence Type	V
Gene Subgroup	3
Gene Designation	9
Allele Designation	i01

Acknowledgements

Individuals acknowledged as contributing to this sequence:

Name	Institution	ORCID ID
William Lees	Birkbeck College, University of London, Malet Street, London
Ayelet Peres	Bar-Ilan University, Ramat-Gan, Israel
Gur Yaari	Bar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.


IARC meeting 62 (Nov 3rd, 2020): The meeting considered the inference of the variant IGHV3-901_t307c, in the VDJbase dataset of sample P1_I86_S1. The sequence was seen in 1.29% of all unmutated rearrangements, with 433 sequences including 368 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-901 was also present in the genotype, at a similar frequency (2.25% of all unmutated sequences, 748 sequences, 641 unmutated sequences). Haplotyping data showed almost perfect separation of the assigned alleles. Plots of the final 3’ nucleotides of the inference were unavailable. The inferred sequence was tentatively affirmed as a Level 1 sequence. The final 3’ nucleotides will be considered at a later date, at which time the affirmed sequence will be noted in the IARC minutes. IARC meeting 83 (Oct 18, 2021): IGHV3-901_T307C was inferred in subject S82 (P1_I86_S1; ERR2567259), a genotype that also expressed IGHV3-901. This inference has previously been pre-assessed at IARC meeting 62 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2021/04/Meeting-62-3_11_20-minutes.pdf). IGHV3-901_T307C was well expressed, represented by 453 sequences, allelic frequency 36%, represented 1.6% of the unmutated population, and had 373 unique CDR3s in the unmutated population. It showed a haplotype ratio (based on association with alleles of IGHJ6) of 100:0 while IGHV3-901 showed a ratio of 1:99. IARC affirms the sequence up to and including base 319 as a level 1 sequence. It is acknowledged that the allele most likely carries 3 additional bases, typically ATA at base position 320-322. The trailing “…” indicates IARC’s opinion that the sequence is likely to contain three additional 3’ nucleotides for which there is insufficient evidence to make an affirmation. The allele is given the name IGHV3-9i01. >IGHV3-9i01 GAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATCACTGTGCAAAAG…

IARC meeting 62 (Nov 3rd, 2020):
The meeting considered the inference of the variant IGHV3-9*01_t307c, in the VDJbase dataset of sample P1_I86_S1. The sequence was seen in 1.29% of all unmutated rearrangements, with 433 sequences including 368 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-9*01 was also present in the genotype, at a similar frequency (2.25% of all unmutated sequences, 748 sequences, 641 unmutated sequences). Haplotyping data showed almost perfect separation of the assigned alleles. Plots of the final 3’ nucleotides of the inference were unavailable. The inferred sequence was tentatively affirmed as a Level 1 sequence. The final 3’ nucleotides will be considered at a later date, at which time the affirmed sequence will be noted in the IARC minutes.

IARC meeting 83 (Oct 18, 2021):
IGHV3-9*01_T307C was inferred in subject S82 (P1_I86_S1; ERR2567259), a genotype that also expressed IGHV3-9*01. This inference has previously been pre-assessed at IARC meeting 62 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2021/04/Meeting-62-3_11_20-minutes.pdf). IGHV3-9*01_T307C was well expressed, represented by 453 sequences, allelic frequency 36%, represented 1.6% of the unmutated population, and had 373 unique CDR3s in the unmutated population. It showed a haplotype ratio (based on association with alleles of IGHJ6) of 100:0 while IGHV3-9*01 showed a ratio of 1:99. IARC affirms the sequence up to and including base 319 as a level 1 sequence. It is acknowledged that the allele most likely carries 3 additional bases, typically ATA at base position 320-322. The trailing “…” indicates IARC’s opinion that the sequence is likely to contain three additional 3’ nucleotides for which there is insufficient evidence to make an affirmation. The allele is given the name IGHV3-9*i01.

>IGHV3-9*i01
GAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATCACTGTGCAAAAG…

Attachments

	Supplementary Files

History

History logs the times and reasons for the publication of each version of this sequence.


Mats Ohlin 2021-11-01 22:49:26	Version 1 published Submission published by IARC on November 1st, 2021


Mats Ohlin 2021-11-17 15:25:07	*IMGT Name updated to IGHV3-904** IMGT Name updated.

Versions

All published versions of this sequence.

Sequence Name	IMGT Name	Alternative names	Inference Type	Affirmation Level	Species subgroup	Subgroup type	Gene start	Gene end	UTR 5' Start	UTR 5' End	L-PART1 Start	L-PART1 End	L-PART2 Start	L-PART2 End	CDR1 Start	CDR1 End	CDR2 Start	CDR2 End	CDR3 Start	v_rs_start	v_rs_end	d_rs_3_prime_start	d_rs_3_prime_end	d_rs_5_prime_start	d_rs_5_prime_end	j_rs_start	j_rs_end	Codon Frame	Version	Date
IGHV3-9*i01	IGHV3-9*04		Rearranged Only	1		none	1	295							76	99	151	174	289									1	1	2021-11-01
IGHV3-9*04	IGHV3-9*04	IGHV3-9*i01	Genomic and rearranged	1			1	295							76	99	151	174	289										2	2023-07-10