IARC meeting 62 (Nov 3rd, 2020):
The meeting considered the inference of the variant IGHV3-9*01_t307c, in the VDJbase dataset of sample P1_I86_S1. The sequence was seen in 1.29% of all unmutated rearrangements, with 433 sequences including 368 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-9*01 was also present in the genotype, at a similar frequency (2.25% of all unmutated sequences, 748 sequences, 641 unmutated sequences). Haplotyping data showed almost perfect separation of the assigned alleles. Plots of the final 3’ nucleotides of the inference were unavailable. The inferred sequence was tentatively affirmed as a Level 1 sequence. The final 3’ nucleotides will be considered at a later date, at which time the affirmed sequence will be noted in the IARC minutes.

IARC meeting 83 (Oct 18, 2021):
IGHV3-9*01_T307C was inferred in subject S82 (P1_I86_S1; ERR2567259), a genotype that also expressed IGHV3-9*01. This inference has previously been pre-assessed at IARC meeting 62 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2021/04/Meeting-62-3_11_20-minutes.pdf). IGHV3-9*01_T307C was well expressed, represented by 453 sequences, allelic frequency 36%, represented 1.6% of the unmutated population, and had 373 unique CDR3s in the unmutated population. It showed a haplotype ratio (based on association with alleles of IGHJ6) of 100:0 while IGHV3-9*01 showed a ratio of 1:99. IARC affirms the sequence up to and including base 319 as a level 1 sequence. It is acknowledged that the allele most likely carries 3 additional bases, typically ATA at base position 320-322. The trailing “…” indicates IARC’s opinion that the sequence is likely to contain three additional 3’ nucleotides for which there is insufficient evidence to make an affirmation. The allele is given the name IGHV3-9*i01.

>IGHV3-9*i01
GAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATCACTGTGCAAAAG…