Details

SpeciesHomo sapiens
Species subgroup
Subgroup typenone
Sequence NameIGHV3-9*i01
IUIS NameIGHV3-9*04
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityF
Inference TypeRearranged Only
Mapped
Paralogs
Paralog Rep

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start76
CDR1 End99
CDR2 Start151
CDR2 End174
CDR3 Start289

Non-Core Regions

Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Additional Information

Sequence IDA00069
CuratorMats Ohlin
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version1
Release Date2021-11-01
Release Notes

Submission published by IARC on November 1st, 2021

LocusIGH
Sequence TypeV
Gene Subgroup3
Gene Designation9
Allele Designationi01
Gene start1
Gene end295

Acknowledgements

Individuals acknowledged as contributing to this sequence:

NameInstitutionORCID ID
William LeesBirkbeck College, University of London, Malet Street, London
Ayelet PeresBar-Ilan University, Ramat-Gan, Israel
Gur YaariBar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.

IARC meeting 62 (Nov 3rd, 2020):
The meeting considered the inference of the variant IGHV3-9*01_t307c, in the VDJbase dataset of sample P1_I86_S1. The sequence was seen in 1.29% of all unmutated rearrangements, with 433 sequences including 368 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-9*01 was also present in the genotype, at a similar frequency (2.25% of all unmutated sequences, 748 sequences, 641 unmutated sequences). Haplotyping data showed almost perfect separation of the assigned alleles. Plots of the final 3’ nucleotides of the inference were unavailable. The inferred sequence was tentatively affirmed as a Level 1 sequence. The final 3’ nucleotides will be considered at a later date, at which time the affirmed sequence will be noted in the IARC minutes.

IARC meeting 83 (Oct 18, 2021):
IGHV3-9*01_T307C was inferred in subject S82 (P1_I86_S1; ERR2567259), a genotype that also expressed IGHV3-9*01. This inference has previously been pre-assessed at IARC meeting 62 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2021/04/Meeting-62-3_11_20-minutes.pdf). IGHV3-9*01_T307C was well expressed, represented by 453 sequences, allelic frequency 36%, represented 1.6% of the unmutated population, and had 373 unique CDR3s in the unmutated population. It showed a haplotype ratio (based on association with alleles of IGHJ6) of 100:0 while IGHV3-9*01 showed a ratio of 1:99. IARC affirms the sequence up to and including base 319 as a level 1 sequence. It is acknowledged that the allele most likely carries 3 additional bases, typically ATA at base position 320-322. The trailing “…” indicates IARC’s opinion that the sequence is likely to contain three additional 3’ nucleotides for which there is insufficient evidence to make an affirmation. The allele is given the name IGHV3-9*i01.

>IGHV3-9*i01
GAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATCACTGTGCAAAAG…

Attachments

Attachment File Name
 

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2021-11-01 22:49:26
Version 1 published

Submission published by IARC on November 1st, 2021

Mats Ohlin
2021-11-17 15:25:07
IMGT Name updated to IGHV3-9*04

IMGT Name updated.

Versions

All published versions of this sequence.

Sequence NameIMGT NameVersionDate
IGHV3-9*i01IGHV3-9*0412021-11-01
IGHV3-9*04IGHV3-9*0422023-07-10