Details

SpeciesHomo sapiens
Species subgroup
Subgroup typenone
Sequence NameIGHV3-30*i01
IUIS NameIGHV3-30*20
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityF
Inference TypeRearranged Only
Mapped
Paralogs
Paralog Rep

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start76
CDR1 End99
CDR2 Start151
CDR2 End174
CDR3 Start289

Non-Core Regions

Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Additional Information

Sequence IDA00067
CuratorMats Ohlin
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version1
Release Date2021-11-01
Release Notes

Submission published by IARC on November 1st, 2021

LocusIGH
Sequence TypeV
Gene Subgroup3
Gene Designation30
Allele Designationi01
Gene start1
Gene end295

Acknowledgements

Individuals acknowledged as contributing to this sequence:

NameInstitutionORCID ID
William LeesBirkbeck College, University of London, Malet Street, London
Ayelet PeresBar-Ilan University, Ramat-Gan, Israel
Gur YaariBar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.

IARC meeting 61 (Oct 13, 2020)
The meeting considered the inference of the variant IGHV3-30*19_t189c, in the VDJbase dataset of sample P1_I49_S1. The sequence was seen in 2.35% of all unmutated rearrangements, with 313 sequences including 113 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-30*18 also present in the genotype. Plots of the final 3’ nucleotides of the inference were unavailable. Discussion particularly focused upon haplotype data relating to IGHV3-30, IGHV3-33 and IGHV3-30-3. These data raise the possibility that the inference is an allele of IGHV3-30-3, though it is most similar to IGHV3-30*19. IARC policy has been that sequences are given an IMGT gene name based upon the sequence to which they are most similar. Consideration of this particular inference led this policy to be reconsidered, and it was agreed that further discussion is required before the policy can be confirmed or modified. Because of the uncertainty regarding the most suitable name for the inferred sequence, it was affirmed as a Level 0 sequence. The final 3’ nucleotides will be considered at a later date, at which time the affirmed sequence will be noted in the IARC minutes. It was noted
that the P1_I49_S1 dataset had a relatively low percentage of unmutated sequences for all genes in the dataset. GY agreed to investigate why this P1 dataset does not share the high percentage of unmutated sequences that is seen in other P1_S1 datasets.

IARC meeting 82 (Oct 11, 2021)
IGHV3-30*19_T189C was inferred in one genotype (VDJbase P1_I49). This inference has previously been pre-assessed at IARC meeting 61 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-61-13_10_20-minutes.pdf). Among alleles of the IGHV3-30/IGHV3-30-3/IGHV3-33 set the genotype in addition also carried IGHV3-30-3*01 and IGHV3-33*01 as defined in OGRDB. The three alleles are supported by similar numbers of sequences (357, 141, and 540), multiple (116, 59, 200) unique CDR3s among unmutated reads. Haplotyping based on alleles of IGHJ6 supported its presence (IGHV3-30*19_T189C ratio: 100:0; IGHV3-30-3*01: 0:100; IGHV3-33*01: 56:44). The sequences are quite similar and theoretically IGHV3-30*19_T189C could have been generated as a chimeric PCR products of rearranged sequences derived from the 5’part IGHV3-33*01 and the 3’-part of IGHV3-30-3*01. However, haplotyping based on IGHJ6 associates IGHV3-30*19_G189C and IGHV3-30-3*01 to different alleles of IGHJ6. Furthermore, a separate study of this data set (DOI: 10.3389/fimmu.2021.730105) defined that the upstream sequences of IGHV3-30*19_T189C and IGHV3-33*01 are substantially different. IGHV3-30*18 have also been found associated to this genotype but it will currently not feature in OGRDB as two alleles have the same sequence, preventing their inclusion in the genotype (it had been observed in the original inference as discussed at meeting 61, above). This allele cannot easily have contributed (by being involved in PCR chimeras) to the inference of IGHV3-30*19_T189C as it differs from the novel allele both in the allele’s 5’ and 3’ end. In addition, its upstream sequence is different from that of IGHV3-30*19_T189C. Altogether there is no evidence that IGHV3-30*19_T189C has been generated as a PCR chimera. IARC affirms the sequence at Level 1 up to and including base 319 in agreement with past practice. It is acknowledged that the allele most likely carries one additional base, typically A at base position 320. A trailing “.” indicates IARC’s opinion that the sequence is likely to contain an additional 3’ nucleotide for which there is insufficient evidence to make an affirmation. The allele is given the name IGHV3-30*i01.

>IGHV3-30*i01
CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGCAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAG.

We recognise that this allele might be located at IGHV3-30, IGHV3-30-3, IGHV3-30-5, and/or IGHV3-33 and IARC gene naming does not reflect a position on this matter.

Attachments

Supplementary Files
 
 Figures IGHV3-30*i01 (IGHV3-30*19-T189C).pdf

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2021-11-01 22:48:56
Version 1 published

Submission published by IARC on November 1st, 2021

Mats Ohlin
2021-11-17 15:24:45
IMGT Name updated to IGHV3-30*20

IMGT Name updated.

Versions

All published versions of this sequence.

Sequence NameIUIS NameVersionDate
IGHV3-30*i01IGHV3-30*2012021-11-01
IGHV3-30*20IGHV3-30*2022023-07-10