Details


Species	Human
Species subgroup
Subgroup type	none
Sequence Name	IGHV3-21*i02
IUIS Name	IGHV3-21*07
Alternative names
Affirmation Level	1
Full Sequence
Coding Sequence
Functionality	F
Inference Type	Rearranged Only
Mapped
Paralogs
Paralog Rep

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele Name	Subjects	Sequence Match
IGHV3-21*01_a184g_t190a_a191c	1

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

CDR delineation


CDR1 Start	76
CDR1 End	99
CDR2 Start	151
CDR2 End	174
CDR3 Start	289

Additional Information


Sequence ID	A00065
Curator	Mats Ohlin
Curator address	Dept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version	1
Release Date	2021-11-01
Release Notes	Submission published by IARC on November 1st, 2021
Locus	IGH
Sequence Type	V
Gene Subgroup	3
Gene Designation	21
Allele Designation	i02

Acknowledgements

Individuals acknowledged as contributing to this sequence:

Name	Institution	ORCID ID
William Lees	Birkbeck College, University of London, Malet Street, London
Ayelet Peres	Bar-Ilan University, Ramat-Gan, Israel
Gur Yaari	Bar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.


IARC Meeting 61 (October 13th 2020): The meeting considered the inference of the variant IGHV3-2101_a184g_t190a_a191c in the VDJbase dataset of sample P1_I80_S1. The sequence was seen in 2.73% of all unmutated rearrangements, with 1207 sequences including 1054 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-2101 was also present in the genotype, at a similar frequency (2.37% of all unmutated sequences, 1066 sequences, 917 unmutated sequences). Plots of the final 3’ nucleotides were unavailable, and no haplotyping data was available. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes. IARC meeting 80 (September 27th, 2021): IGHV3-2101_A184G_T190A_A191C was inferred in the genotype of subject S76 (VDJbase: P1_I80). This inference has previously been pre-assessed at IARC meeting 61 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-61-13_10_20-minutes.pdf). The genotype also carried IGHV3-2101. Both alleles were represented in high numbers (2.9% and 2.5% of the total unmutated population). IGHV3-2101_A184G_T190A_A191 was represented by 1306 sequences, 1092 unmutated sequences, an allelic frequency of 53%, and 1069 unique CDR3s in the unmutated sequence set. Haplotyping based on differences in IGHJ6 alleles was not possible for this dataset. >IGHV3-2101_A184G_T190A_A191C GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTGGTAGTACCATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA The sequence is inferred at Level 1. IARC affirms the sequence up to and including base 320 based on the convincing evidence of the sequence end as presented in the OGRDBplot.

IARC Meeting 61 (October 13th 2020):
The meeting considered the inference of the variant IGHV3-21*01_a184g_t190a_a191c in the VDJbase dataset of sample P1_I80_S1. The sequence was seen in 2.73% of all unmutated rearrangements, with 1207 sequences including 1054 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-21*01 was also present in the genotype, at a similar frequency (2.37% of all unmutated sequences, 1066 sequences, 917 unmutated sequences). Plots of the final 3’ nucleotides were unavailable, and no haplotyping data was available. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes.

IARC meeting 80 (September 27th, 2021):
IGHV3-21*01_A184G_T190A_A191C was inferred in the genotype of subject S76 (VDJbase: P1_I80). This inference has previously been pre-assessed at IARC meeting 61 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-61-13_10_20-minutes.pdf). The genotype also carried IGHV3-21*01. Both alleles were represented in high numbers (2.9% and 2.5% of the total unmutated population). IGHV3-21*01_A184G_T190A_A191 was represented by 1306 sequences, 1092 unmutated sequences, an allelic frequency of 53%, and 1069 unique CDR3s in the unmutated sequence set. Haplotyping based on differences in IGHJ6 alleles was not possible for this dataset.

>IGHV3-21*01_A184G_T190A_A191C
GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTGGTAGTACCATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA

The sequence is inferred at Level 1. IARC affirms the sequence up to and including base 320 based on the convincing evidence of the sequence end as presented in the OGRDBplot.

Attachments

	Supplementary Files

History

History logs the times and reasons for the publication of each version of this sequence.


Mats Ohlin 2021-11-01 22:48:38	Version 1 published Submission published by IARC on November 1st, 2021


Mats Ohlin 2021-11-17 15:24:26	*IMGT Name updated to IGHV3-2107** IMGT Name updated.

Versions

All published versions of this sequence.

Sequence Name	IMGT Name	Alternative names	Inference Type	Affirmation Level	Species subgroup	Subgroup type	Gene start	Gene end	UTR 5' Start	UTR 5' End	L-PART1 Start	L-PART1 End	L-PART2 Start	L-PART2 End	CDR1 Start	CDR1 End	CDR2 Start	CDR2 End	CDR3 Start	v_rs_start	v_rs_end	d_rs_3_prime_start	d_rs_3_prime_end	d_rs_5_prime_start	d_rs_5_prime_end	j_rs_start	j_rs_end	Codon Frame	Version	Date
IGHV3-21*i02	IGHV3-21*07		Rearranged Only	1		none	1	296							76	99	151	174	289									1	1	2021-11-01
IGHV3-21*07	IGHV3-21*07	IGHV3-21*i02	Rearranged Only	1			1	296							76	99	151	174	289										2	2023-07-10