IARC Meeting 61 (October 13th 2020):
The meeting considered the inference of the variant IGHV3-21*01_a184g_t190a_a191c in the VDJbase dataset of sample P1_I80_S1. The sequence was seen in 2.73% of all unmutated rearrangements, with 1207 sequences including 1054 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-21*01 was also present in the genotype, at a similar frequency (2.37% of all unmutated sequences, 1066 sequences, 917 unmutated sequences). Plots of the final 3’ nucleotides were unavailable, and no haplotyping data was available. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes.

IARC meeting 80 (September 27th, 2021):
IGHV3-21*01_A184G_T190A_A191C was inferred in the genotype of subject S76 (VDJbase: P1_I80). This inference has previously been pre-assessed at IARC meeting 61 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-61-13_10_20-minutes.pdf). The genotype also carried IGHV3-21*01. Both alleles were represented in high numbers (2.9% and 2.5% of the total unmutated population). IGHV3-21*01_A184G_T190A_A191 was represented by 1306 sequences, 1092 unmutated sequences, an allelic frequency of 53%, and 1069 unique CDR3s in the unmutated sequence set. Haplotyping based on differences in IGHJ6 alleles was not possible for this dataset.

>IGHV3-21*01_A184G_T190A_A191C
GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTGGTAGTACCATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA

The sequence is inferred at Level 1. IARC affirms the sequence up to and including base 320 based on the convincing evidence of the sequence end as presented in the OGRDBplot.