Details

SpeciesHuman
Species subgroup
Subgroup typenone
Sequence NameIGHV3-21*i02
IUIS NameIGHV3-21*07
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalTrue
Inference TypeRearranged Only
Alternative names
Paralogs

Evidence

The table below lists the submissions, and the inferences within them, on which this published sequence is based. The list may be short when the sequence is first published, containing, for example, reference to just a single submission, but is expected to grow over time as additional inferences are submitted.

'Sequence Match' indicates whether the inference exactly matches the sequence, and clicking on the tick or cross will provide an alignment. Mismatches may be caused, for example, by the inclusion of leader sequences, or nucleotides in the inference which do not in IARC's opinion have sufficient evidence for inclusion in the sequence.

Submission IDAccession NoSubject IDGenotype NameSequence NameSequence Match
S00031 OU596107S76P1_I80_S1IGHV3-21*01_A184G_T190A_A191C

Supporting Observations

Sequences in other published genotypes which have been identified by IARC and support the inference:

No Items

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

No Items

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

Additional Information

Sequence IDA00065
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version1
Release Date2021-11-01
Release Notes

Submission published by IARC on November 1st, 2021

LocusIGH
Sequence TypeV
Gene Subgroup3
Gene Designation21
Allele Designationi02

Acknowledgements

Individuals acknowledged as contributing to this sequence:

NameInstitutionORCID ID
William LeesBirkbeck College, University of London, Malet Street, London
Ayelet PeresBar-Ilan University, Ramat-Gan, Israel
Gur YaariBar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.

IARC Meeting 61 (October 13th 2020):
The meeting considered the inference of the variant IGHV3-21*01_a184g_t190a_a191c in the VDJbase dataset of sample P1_I80_S1. The sequence was seen in 2.73% of all unmutated rearrangements, with 1207 sequences including 1054 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-21*01 was also present in the genotype, at a similar frequency (2.37% of all unmutated sequences, 1066 sequences, 917 unmutated sequences). Plots of the final 3’ nucleotides were unavailable, and no haplotyping data was available. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes.

IARC meeting 80 (September 27th, 2021):
IGHV3-21*01_A184G_T190A_A191C was inferred in the genotype of subject S76 (VDJbase: P1_I80). This inference has previously been pre-assessed at IARC meeting 61 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-61-13_10_20-minutes.pdf). The genotype also carried IGHV3-21*01. Both alleles were represented in high numbers (2.9% and 2.5% of the total unmutated population). IGHV3-21*01_A184G_T190A_A191 was represented by 1306 sequences, 1092 unmutated sequences, an allelic frequency of 53%, and 1069 unique CDR3s in the unmutated sequence set. Haplotyping based on differences in IGHJ6 alleles was not possible for this dataset.

>IGHV3-21*01_A184G_T190A_A191C
GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTGGTAGTACCATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA

The sequence is inferred at Level 1. IARC affirms the sequence up to and including base 320 based on the convincing evidence of the sequence end as presented in the OGRDBplot.

Attachments

Attachment File Name
 

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2021-11-01 22:48:38
Version 1 published

Submission published by IARC on November 1st, 2021

Mats Ohlin
2021-11-17 15:24:26
IMGT Name updated to IGHV3-21*07

IMGT Name updated.

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGHV3-21*i02IGHV3-21*07Rearranged Only1none12021-11-01