Details

SpeciesHomo sapiens
Species subgroup
Subgroup typenone
Sequence NameIGHV3-21*i02
IUIS NameIGHV3-21*07
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityF
Inference TypeRearranged Only
Mapped
Paralogs
Paralog Rep

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start76
CDR1 End99
CDR2 Start151
CDR2 End174
CDR3 Start289

Non-Core Regions

Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Additional Information

Sequence IDA00065
CuratorMats Ohlin
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version1
Release Date2021-11-01
Release Notes

Submission published by IARC on November 1st, 2021

LocusIGH
Sequence TypeV
Gene Subgroup3
Gene Designation21
Allele Designationi02
Gene start1
Gene end296

Acknowledgements

Individuals acknowledged as contributing to this sequence:

NameInstitutionORCID ID
William LeesBirkbeck College, University of London, Malet Street, London
Ayelet PeresBar-Ilan University, Ramat-Gan, Israel
Gur YaariBar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.

IARC Meeting 61 (October 13th 2020):
The meeting considered the inference of the variant IGHV3-21*01_a184g_t190a_a191c in the VDJbase dataset of sample P1_I80_S1. The sequence was seen in 2.73% of all unmutated rearrangements, with 1207 sequences including 1054 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-21*01 was also present in the genotype, at a similar frequency (2.37% of all unmutated sequences, 1066 sequences, 917 unmutated sequences). Plots of the final 3’ nucleotides were unavailable, and no haplotyping data was available. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes.

IARC meeting 80 (September 27th, 2021):
IGHV3-21*01_A184G_T190A_A191C was inferred in the genotype of subject S76 (VDJbase: P1_I80). This inference has previously been pre-assessed at IARC meeting 61 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-61-13_10_20-minutes.pdf). The genotype also carried IGHV3-21*01. Both alleles were represented in high numbers (2.9% and 2.5% of the total unmutated population). IGHV3-21*01_A184G_T190A_A191 was represented by 1306 sequences, 1092 unmutated sequences, an allelic frequency of 53%, and 1069 unique CDR3s in the unmutated sequence set. Haplotyping based on differences in IGHJ6 alleles was not possible for this dataset.

>IGHV3-21*01_A184G_T190A_A191C
GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTGGTAGTACCATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA

The sequence is inferred at Level 1. IARC affirms the sequence up to and including base 320 based on the convincing evidence of the sequence end as presented in the OGRDBplot.

Attachments

Supplementary Files
 

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2021-11-01 22:48:38
Version 1 published

Submission published by IARC on November 1st, 2021

Mats Ohlin
2021-11-17 15:24:26
IMGT Name updated to IGHV3-21*07

IMGT Name updated.

Versions

All published versions of this sequence.

Sequence NameIMGT NameVersionDate
IGHV3-21*i02IGHV3-21*0712021-11-01
IGHV3-21*07IGHV3-21*0722023-07-10