Sequence IGKV3-15*01 A117G has been discussed during IARC meetings 132-135.

The inference was originally reported in Mikocziova et al. iScience 2021, 24, 103192 (https://doi.org/10.1016/j.isci.2021.103192).

IGKV3-15*01_G107A was inferred in VDJbase sample P1_I12_S1.
The data had been analyzed in the past (see IARC meetings 132-134). This sample’s genotype also carries IGKV3-15*01 and a substantially lower number of sequences of IGKV3D-15*01 (about 9-fold). The relatively high expression of IGKV3-15*01_G107A suggests that the allele was found in the proximal and to the typically less expressed distal IGKV locus. It was supported by 811 unmutated sequences and 655 unique CDR3s in the unmutated sequence set. The allelic ratio for IGKV3-15*01_G107A / IGKV3-15*01 was 56/44. Haplotyping associated IGKV3-15*01_G107A to IGKJ2*01 while IGKV3-15*01 associated to IGKJ2*04. IGKV3D-15*01 associated to both haplotypes as defined by alleles of IGKJ2.

Now, reanalysis (March, 2024) of the data using an updated pipeline of VDJbase and employing the AIRR-C reference set has generated updated information on this inference (see enclosure), demonstrating

• a diversity of CDR3 lengths of reads associated to IGKV3-15*01 G107A.
• high representation of the inferred sequence in the data set (1035 and 1282 for IGKV3-15*01 and IGKV3-15*01 G107A, respectively) many of which were unmutated (approx. 70%) and carried multiple different CDR3 sequences. IGKV3D-15*01 was represented in the transcriptome with an approximately 9-fold lower number of reads.
• a predominance of the TCC triplet was found as the final three bases
• haplotyping demonstrated the association of IGKV3-15*01 and IGKV3-15*01 G107A to IGKJ2*04 and IGKJ2*01, respectively.

The sequence is also inferred in VDJbase P1_I43_S1 and P1_I91_S1 but no haplotyping data are available for those samples.

There is no entry in GenBank or among genomic entries in VDJbase that is identical to the full sequence of IGKV3-15*01_G107A.

>IGKV3-15*01_G107A
GAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAACAGCAACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCACCAGGGCCACTGGTATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCC

IARC affirms the sequence based on inference of expression data alone at Level 1 up to and including base 332 in agreement with past practice related to the process of trimming of the 3’-end during the rearrangement process. It is acknowledged that the allele most likely carries three additional bases, typically TCC at base positions 333-335. Trailing “…” of the affirmed sequence indicates IARC’s opinion that the sequence is likely to contain additional 3’ nucleotides for which there is insufficient evidence to make an affirmation. The sequence is given the name IGKV3-15*i01. For many applications, it will be important to use the full length sequence, in which case the three most likely bases at the 3’-end should be added to the affirmed sequence. Immunoglobulin loci are highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. Inference from transcriptomic data does not firmly associate an allele to a given gene. The name (with an “i” allele designation) of an inferred allele thus does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question.

Affirmed sequence:
>IGKV3-15*i01
GAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAACAGCAACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCACCAGGGCCACTGGTATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCC…