Details

SpeciesHomo sapiens
Species subgroup
Subgroup typenone
Sequence NameIGHV3-13*i01
IUIS Name
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityF
Inference TypeRearranged Only
Mapped
Paralogs
Paralog Rep

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start76
CDR1 End99
CDR2 Start151
CDR2 End171
CDR3 Start286

Additional Information

Sequence IDA02566
CuratorMats Ohlin
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version1
Release Date2023-03-20
Release Notes

Published by IARC on March 20th, 2023.

LocusIGH
Sequence TypeV
Gene Subgroup3
Gene Designation13
Allele Designationi01
Gene start1
Gene end292

Acknowledgements

Individuals acknowledged as contributing to this sequence:

NameInstitutionORCID ID
William LeesBirkbeck College, University of London, Malet Street, London
Ayelet PeresBar-Ilan University, Ramat-Gan, Israel
Gur YaariBar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.

The inference IGHV3−13*01_G290A_T300C was considered at IARC meeting 116 on Feb 27th, 2023.

IGHV3−13*01_G290A_T300C has been inferred in one genotype (P1_I10) in VDJbase P1 data set. The genotype does not carry a related allele and the opposite haplotype carries a large deletion that involves IGHV3-13 (Gidoni et al. (2019) Nat Commun 10, 628. DOI: 10.1038/s41467-019-08489-3). It represents 0.23% of the total unmutated population, it is represented by 71 unmutated error-free sequences and 68 unique CDR3s of different lengths in the error-free set. Haplotyping based on allelic diversity in IGHJ6 demonstrates association of the haplotype defined by IGHJ6*03 (100:0 ratio). This allele is also inferred in multiple other data sets, two of which can be haplotyped. In both cases the inferred allele separates appropriately from IGHV3-13*05 (P1_I69) and IGHV3-13*04 (P1_I93) as determined by haplotyping.

IARC affirms the sequence as IGHV3-13*i01 at Level 1 up to and including base 319. It is acknowledged that the allele most likely carries 1 additional base, typically A, at base positions 320. Trailing “.” indicates IARC’s opinion that the sequence is likely to contain additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence.

>IGHV3-13*i01
GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCAAGAG.

The locus on chromosome 14 that carries human IGHV genes is highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. No other highly similar genes have been described.

Attachments

Supplementary Files
 IGHV3-13*i01_meeting 116.pdf

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2023-03-20 08:44:52
Version 1 published

Published by IARC on March 20th, 2023.

Versions

All published versions of this sequence.

Sequence NameIMGT NameVersionDate
IGHV3-13*i0112023-03-20
IGHV3-13*i0122023-07-10
IGHV3-13*06IGHV3-13*0632024-01-11