The inference IGHV3−13*01_G290A_T300C was considered at IARC meeting 116 on Feb 27th, 2023.

IGHV3−13*01_G290A_T300C has been inferred in one genotype (P1_I10) in VDJbase P1 data set. The genotype does not carry a related allele and the opposite haplotype carries a large deletion that involves IGHV3-13 (Gidoni et al. (2019) Nat Commun 10, 628. DOI: 10.1038/s41467-019-08489-3). It represents 0.23% of the total unmutated population, it is represented by 71 unmutated error-free sequences and 68 unique CDR3s of different lengths in the error-free set. Haplotyping based on allelic diversity in IGHJ6 demonstrates association of the haplotype defined by IGHJ6*03 (100:0 ratio). This allele is also inferred in multiple other data sets, two of which can be haplotyped. In both cases the inferred allele separates appropriately from IGHV3-13*05 (P1_I69) and IGHV3-13*04 (P1_I93) as determined by haplotyping.

IARC affirms the sequence as IGHV3-13*i01 at Level 1 up to and including base 319. It is acknowledged that the allele most likely carries 1 additional base, typically A, at base positions 320. Trailing “.” indicates IARC’s opinion that the sequence is likely to contain additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence.

>IGHV3-13*i01
GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCAAGAG.

The locus on chromosome 14 that carries human IGHV genes is highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. No other highly similar genes have been described.