Details


Species	Human
Species subgroup
Subgroup type	none
Sequence Name	IGHV3-13*i01
IUIS Name
Alternative names
Affirmation Level	1
Full Sequence
Coding Sequence
Functionality	F
Inference Type	Rearranged
Alternative names
Paralogs

Evidence

The table below lists the submissions, and the inferences within them, on which this published sequence is based. The list may be short when the sequence is first published, containing, for example, reference to just a single submission, but is expected to grow over time as additional inferences are submitted.

'Sequence Match' indicates whether the inference exactly matches the sequence, and clicking on the tick or cross will provide an alignment. Mismatches may be caused, for example, by the inclusion of leader sequences, or nucleotides in the inference which do not in IARC's opinion have sufficient evidence for inclusion in the sequence.

Submission ID	Accession No	Subject ID	Genotype Name	Sequence Name	Sequence Match
S00038	OX384051	S10	P1_I10_S1	IGHV3-13*01_G290A_T300C

Supporting Observations

Sequences in other published genotypes which have been identified by IARC and support the inference:

No Items

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele Name	Subjects	Sequence Match
IGHV3-13*01_g290a_t300c	14

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

Non-Core Regions


UTR 5' Start
UTR 5' End
L-PART1 Start
L-PART1 End
L-PART2 Start
L-PART2 End
v_rs_start
v_rs_end

Extension


3' Extension
3' start
3' end
5' start
5' end

Additional Information


Sequence ID	A02566
Curator address	Dept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version	1
Release Date	2023-03-20
Release Notes	Published by IARC on March 20th, 2023.
Locus	IGH
Sequence Type	V
Gene Subgroup	3
Gene Designation	13
Allele Designation	i01

Acknowledgements

Individuals acknowledged as contributing to this sequence:

Name	Institution	ORCID ID
William Lees	Birkbeck College, University of London, Malet Street, London
Ayelet Peres	Bar-Ilan University, Ramat-Gan, Israel
Gur Yaari	Bar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.


The inference IGHV3−1301_G290A_T300C was considered at IARC meeting 116 on Feb 27th, 2023. IGHV3−1301_G290A_T300C has been inferred in one genotype (P1_I10) in VDJbase P1 data set. The genotype does not carry a related allele and the opposite haplotype carries a large deletion that involves IGHV3-13 (Gidoni et al. (2019) Nat Commun 10, 628. DOI: 10.1038/s41467-019-08489-3). It represents 0.23% of the total unmutated population, it is represented by 71 unmutated error-free sequences and 68 unique CDR3s of different lengths in the error-free set. Haplotyping based on allelic diversity in IGHJ6 demonstrates association of the haplotype defined by IGHJ603 (100:0 ratio). This allele is also inferred in multiple other data sets, two of which can be haplotyped. In both cases the inferred allele separates appropriately from IGHV3-1305 (P1_I69) and IGHV3-1304 (P1_I93) as determined by haplotyping. IARC affirms the sequence as IGHV3-13i01 at Level 1 up to and including base 319. It is acknowledged that the allele most likely carries 1 additional base, typically A, at base positions 320. Trailing “.” indicates IARC’s opinion that the sequence is likely to contain additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence. >IGHV3-13*i01 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCAAGAG. The locus on chromosome 14 that carries human IGHV genes is highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. No other highly similar genes have been described.

The inference IGHV3−13*01_G290A_T300C was considered at IARC meeting 116 on Feb 27th, 2023.

IGHV3−13*01_G290A_T300C has been inferred in one genotype (P1_I10) in VDJbase P1 data set. The genotype does not carry a related allele and the opposite haplotype carries a large deletion that involves IGHV3-13 (Gidoni et al. (2019) Nat Commun 10, 628. DOI: 10.1038/s41467-019-08489-3). It represents 0.23% of the total unmutated population, it is represented by 71 unmutated error-free sequences and 68 unique CDR3s of different lengths in the error-free set. Haplotyping based on allelic diversity in IGHJ6 demonstrates association of the haplotype defined by IGHJ6*03 (100:0 ratio). This allele is also inferred in multiple other data sets, two of which can be haplotyped. In both cases the inferred allele separates appropriately from IGHV3-13*05 (P1_I69) and IGHV3-13*04 (P1_I93) as determined by haplotyping.

IARC affirms the sequence as IGHV3-13*i01 at Level 1 up to and including base 319. It is acknowledged that the allele most likely carries 1 additional base, typically A, at base positions 320. Trailing “.” indicates IARC’s opinion that the sequence is likely to contain additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence.

>IGHV3-13*i01
GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCAAGAG.

The locus on chromosome 14 that carries human IGHV genes is highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. No other highly similar genes have been described.

Attachments

	Supplementary Files
	IGHV3-13*i01_meeting 116.pdf

History

History logs the times and reasons for the publication of each version of this sequence.


Mats Ohlin 2023-03-20 08:44:52	Version 1 published Published by IARC on March 20th, 2023.

Versions

All published versions of this sequence.

Sequence Name	IMGT Name	Alternative names	Inference Type	Affirmation Level	Species subgroup	Subgroup type	Version	Date
IGHV3-13*i01			Rearranged	1		none	1	2023-03-20