Notes

IGLJ genes for use with all strains

As published in Kos et al. (2022) (in preparation)

Details

AuthorWilliam Lees
Lab Name
Lab AddressBirkbeck College, University of London, Malet Street, London
NameIGLJ (all strains)
SpeciesMouse
Species subgroup
Subgroup typenone
LocusIGL
Release Version1
Release DescriptionFirst release
Release Date2022-05-31

Included Sequences

LabelVnDateIMGT NameAlt NamesFunctionalitySubgrpSequenceGapped Sequence
IGLJ-2ERU 12022-05-31Kos et al: IGLJ2*01_2FTTATGTTTTCGGCAGTGGAACCAAGGTCACTGTCCTAGTTATGTTTTCGGCAGTGGAACCAAGGTCACTGTCCTAG
IGLJ-ACBW 12022-05-31IGLJ2*01Kos et al: IGLJ2*01FTTATGTTTTCGGCGGTGGAACCAAGGTCACTGTCCTAGTTATGTTTTCGGCGGTGGAACCAAGGTCACTGTCCTAG
IGLJ-FMEA 12022-05-31IGLJ1*01Kos et al: IGLJ1*01FCTGGGTGTTCGGTGGAGGAACCAAACTGACTGTCCTAGCTGGGTGTTCGGTGGAGGAACCAAACTGACTGTCCTAG
IGLJ-KL6B 12022-05-31IGLJ3*01Kos et al: IGLJ3*01FGTTTATTTTCGGCAGTGGAACCAAGGTCACTGTCCTAGGTTTATTTTCGGCAGTGGAACCAAGGTCACTGTCCTAG
IGLJ-PG3G 12022-05-31IGLJ4*01Kos et al: IGLJ4*01FTTGGGTGTTCGGAGGTGGAACCAGATTGACTGTCCTAGATGATTGGGTGTTCGGAGGTGGAACCAGATTGACTGTCCTAGATGA
IGLJ-UWMQ 12022-05-31IGLJ3P*01Kos et al: IGLJ3P*01FAGGTTCTTTTTCCTCAAATGGCCTATTGTATGCAGGAGAGGTTCTTTTTCCTCAAATGGCCTATTGTATGCAGGAG
IGLJ-XVAO 12022-05-31Kos et al: IGLJ1*01_1FCTGGGTGTTCGGTGGAGGAACCAAATTGACTGTCCTAGCTGGGTGTTCGGTGGAGGAACCAAATTGACTGTCCTAG

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

History

History logs the times and reasons for the publication of each version of this germline set. Key changes are noted. For detailed changes, click on the link to the sequence.

William Lees
2022-05-31 09:20:45
Mouse germline set G00055 (IGLJ (all strains)) created

Mouse germline set G00055 (IGLJ (all strains)) created

William Lees
2022-05-31 09:22:54
Version 1 published

First release

Versions

All published versions of this germline set.

Set NameSpeciesSpecies subgroupLocusRelease VersionRelease Date
IGLJ (all strains)MouseIGL12022-05-31