Notes

The germline set is based on sequences published in Watson et al. (2019)

Details

AuthorWilliam Lees
Lab Name
Lab AddressBirkbeck College, University of London, Malet Street, London
NameMSM/MsJ IGH
SpeciesMouse
Species subgroupMSM/MsJ
Subgroup typestrain
LocusIGH
Release Version1
Release DescriptionThe germline set is based on sequences published in Watson et al. (2019)
Release Date2022-05-15

Included Sequences

LabelVnDateIMGT NameAlt NamesFunctionalitySubgrpSequenceGapped Sequence
IGHD-25TR 12022-05-15IGHD3-2*01|Mus_musculus_BALB/cwatson_et_al:MSM_MsJ_IGHD3-2*01FMSM/MsJAGACAGCTCGGGCTACAGACAGCTCGGGCTAC
IGHD-2ZLC 12022-05-15IGHD2-5*01|Mus_musculus_CB.20,IGHD2-6*01|Mus_musculus_C57BL/6Jwatson_et_al:MSM_MsJ_IGHD2-5*01|IGHD2-6*01FMSM/MsJCCTACTATAGTAACTACCCTACTATAGTAACTAC
IGHD-BCLQ 12022-05-15IGHD2-2*01|Mus_musculus_BALB/c,IGHD2-7*01|Mus_musculus_BALB/cwatson_et_al:MSM_MsJ_IGHD2-2*01|IGHD2-7*01FMSM/MsJTCTACTATGGTTACGACTCTACTATGGTTACGAC
IGHD-D5PR 12022-05-15IGHD2-4*01|Mus_musculus_BALB/c,IGHD2-9*02|Mus_musculus_129/Svwatson_et_al:MSM_MsJ_IGHD2-4*01|IGHD2-9*02FMSM/MsJTCTACTATGATTACGACTCTACTATGATTACGAC
IGHD-FBFM 12022-05-15IGHD4-1*01|Mus_musculus_BALB/cwatson_et_al:MSM_MsJ_IGHD4-1*01FMSM/MsJCTAACTGGGACCTAACTGGGAC
IGHD-JH5Q 12022-05-15IGHD2-3*01|Mus_musculus_BALB/cwatson_et_al:MSM_MsJ_IGHD2-3*01FMSM/MsJTCTATGATGGTTACTACTCTATGATGGTTACTAC
IGHD-NFS3 12022-05-15IGHD4-1*02|Mus_musculus_BALB/cwatson_et_al:MSM_MsJ_IGHD4-1*02FMSM/MsJCAACTGGGACCAACTGGGAC
IGHD-TDIN 12022-05-15IGHD2-1*01|Mus_musculus_129/Sv,IGHD2-8*01|Mus_musculus_BALB/cwatson_et_al:MSM_MsJ_IGHD2-1*01|IGHD2-8*01FMSM/MsJTCTACTATGGTAACTACTCTACTATGGTAACTAC
IGHD-UXMZ 12022-05-15IGHD1-1*01|Mus_musculus_BALB/cwatson_et_al:MSM_MsJ_IGHD1-1*01FMSM/MsJTTTATTACTACGGTAGTAGCTACTTTATTACTACGGTAGTAGCTAC
IGHJ-2NLR 12022-05-15IGHJ2*01|Mus_musculuswatson_et_al:MSM_MsJ_IGHJ2*02FMSM/MsJACTACTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAGACTACTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAG
IGHJ-AJMV 12022-05-15IGHJ1*03|Mus_musculus_A/Jwatson_et_al:MSM_MsJ_IGHJ1*03FMSM/MsJCTACTGGTACTTCGATGTCTGGGGCACAGGGACCACGGTCACCGTCTCCTCAGCTACTGGTACTTCGATGTCTGGGGCACAGGGACCACGGTCACCGTCTCCTCAG
IGHJ-KMFY 12022-05-15IGHJ4*01|Mus_musculuswatson_et_al:MSM_MsJ_IGHJ4*01FMSM/MsJATTACTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGATTACTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAG
IGHJ-SES2 12022-05-15IGHJ3*01|Mus_musculuswatson_et_al:MSM_MsJ_IGHJ3*01FMSM/MsJCCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAGCCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAG
IGHV-23CQ 12022-05-15IGHV2-9-2*01|Mus_musculus_129/Svwatson_et_al:MSM_MsJ_IGHV2-10FMSM/MsJCAGGTGCAACTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATTACCTGCACTGTCTCTGGGTTCTCATTAACCAGCTATGATATAAGCTGGATTCGCCAGCCACCAGGAAAGGGTCTGGAGTGGCTTGGAGTAATATGGACTGGTGGAGGCACAAATTATAATTCAGCTTTCATGTCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATATATTACTGTGTACAGGTGCAACTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATTACCTGCACTGTCTCTGGGTTCTCATTA............ACCAGCTATGATATAAGCTGGATTCGCCAGCCACCAGGAAAGGGTCTGGAGTGGCTTGGAGTAATATGGACTGGT.........GGAGGCACAAATTATAATTCAGCTTTCATG...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATATATTACTGTGTA
IGHV-25EB 12022-05-15IGHV1-77*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-30FMSM/MsJCAGGTCCAGCTGAAGCAGTCTGGAGCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACCTTCACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAAAGATTGGTCCTGGAAGTGGTAGTACTTACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCAACAGGTCCAGCTGAAGCAGTCTGGAGCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACCTTC............ACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAAAGATTGGTCCTGGA......AGTGGTAGTACTTACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCAA
IGHV-2F6T 12022-05-15IGHV3-8*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV3-2FMSM/MsJGAGGTGCAGCTTCAGGAGTCAGGACCTGGCCTGGCAAAACCTTCTCAGACTCTGTCCCTCACCTGTTCTGTCACTGGCTACTCCATCACCAGTGATTACTGGAACTGGATCCGGAAATTCCCAGGGAATAAACTTGAGTACATGGGGTACATAAGCTACAGTGGTAGCACTTACTACAATCCATCTCTCAAAAGTCGAATCTCCATAACTCGAGACACATCCAAGAACCAGTATTACCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCAAGGAGGTGCAGCTTCAGGAGTCAGGACCT...GGCCTGGCAAAACCTTCTCAGACTCTGTCCCTCACCTGTTCTGTCACTGGCTACTCCATC............ACCAGTGATTACTGGAACTGGATCCGGAAATTCCCAGGGAATAAACTTGAGTACATGGGGTACATAAGCTACAGT.........GGTAGCACTTACTACAATCCATCTCTCAAA...AGTCGAATCTCCATAACTCGAGACACATCCAAGAACCAGTATTACCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCAAG
IGHV-2JMR 12022-05-15IGHV1-18*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-3FMSM/MsJGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATACCCTGCAAGGCTTCTGGATACACATTCACTGACTACAACATGGACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAACAATGGTGGTACTATCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACACTGCAGTCTATTACTGTGCAAGGAGGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATACCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACAACATGGACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAAC......AATGGTGGTACTATCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACACTGCAGTCTATTACTGTGCAAG
IGHV-2LUL 12022-05-15IGHV1-76*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-29FMSM/MsJCAGGTCCAGCTGAAGCAGTCTGGGGCTGAGCTGGTGAGGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACTTTCACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGCAAGGATTTATCCTGGAAGTGGTAATACTTACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGAAAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCTGTCTATTTCTGTGCCAGGTCCAGCTGAAGCAGTCTGGGGCT...GAGCTGGTGAGGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACTTTC............ACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGCAAGGATTTATCCTGGA......AGTGGTAATACTTACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGAAAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCTGTCTATTTCTGTGC
IGHV-2O3V 12022-05-15IGHV8-12*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV8-1FMSM/MsJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGTCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTCTGGTATGGGTGTGAGCTGGATTCGTCAGCCTTCAGGAAAGGGTCTGGAGTGGCTGGCACACATTTACTGGGATGATGACAAGCGCTATAACCCATCCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAGAAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCGCAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGTCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTCTGGTATGGGTGTGAGCTGGATTCGTCAGCCTTCAGGAAAGGGTCTGGAGTGGCTGGCACACATTTACTGGGAT.........GATGACAAGCGCTATAACCCATCCCTGAAG...AGCCGGCTCACAATCTCCAAGGATACCTCCAGAAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCG
IGHV-2VGF 12022-05-15IGHV6-3*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV6-1FMSM/MsJGAAGTGAAGCTTGAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTTGCCTCTGGATTCACTTTCAGTAACTACTGGATGAACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTCAAATTAGATTGAAATCTGATAATTATGCAACACATTATGCGGAGTCTGTGAAAGGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGGGCTGAAGACACTGGAATTTATTACTGCGAAGTGAAGCTTGAGGAGTCTGGAGGA...GGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTTGCCTCTGGATTCACTTTC............AGTAACTACTGGATGAACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTCAAATTAGATTGAAATCTGATAATTATGCAACACATTATGCGGAGTCTGTGAAA...GGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGGGCTGAAGACACTGGAATTTATTACTGC
IGHV-2ZSK 12022-05-15IGHV1-19*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-4FMSM/MsJGAGGTCCAGCTGCAACAGTCTGGACCTGTGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTCACTGACTACTATATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGTTATTAATCCTTACAACGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTTGACAAGTCCTCCAGCACAGCCTACATGGAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGGAGGTCCAGCTGCAACAGTCTGGACCT...GTGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTC............ACTGACTACTATATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGTTATTAATCCTTAC......AACGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTTGACAAGTCCTCCAGCACAGCCTACATGGAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAG
IGHV-3D4C 12022-05-15IGHV1-58*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-17FMSM/MsJGAGGTCCAGCTTCAGCAGTCTGGAGCTGAGCTGGTGAGGCCTGGGTCCTCAGTGAAGATGTCCTGCAAGACTTCTGGATATACATTCACAAGCTACGGTATAAACTGGGTGAAGCAGAGGCCTGGACAGGGCCTGGAATGGATTGGATATATTTATATTGGAAATGGTTATACTGAGTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTTCAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAATCTATTTCTGTGCGAGGTCCAGCTTCAGCAGTCTGGAGCT...GAGCTGGTGAGGCCTGGGTCCTCAGTGAAGATGTCCTGCAAGACTTCTGGATATACATTC............ACAAGCTACGGTATAAACTGGGTGAAGCAGAGGCCTGGACAGGGCCTGGAATGGATTGGATATATTTATATTGGA......AATGGTTATACTGAGTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTTCAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAATCTATTTCTGTGC
IGHV-5DJX 12022-05-15IGHV1-66*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-23FMSM/MsJCAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACAGCTTCACAAGCTACTATATACACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTGGAAGTGGTAATACTAAGTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACGGCAGACACATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTAACATCTGAGGACTCTGCGGTCTATTACTGTCAGGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACAGCTTC............ACAAGCTACTATATACACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTGGA......AGTGGTAATACTAAGTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACGGCAGACACATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTAACATCTGAGGACTCTGCGGTCTATTACTGT
IGHV-5HIY 12022-05-15IGHV1-15*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-2FMSM/MsJCAGGTTCAACTGCAGCAGTCTGGGGCTGAGCTGGTGAGGCCTGGGGCTTCAGTGACGCTGTCCTGCAAGGCTTCGGGCTACACATTTACTGACTATGAAATGCACTGGGTGAAGCAGACACCTGTGCATGGCCTGGAATGGATTGGAGCTATTGATCCTGAAACTGGTGGTACTGCCTACAATCAGAAGTTCAAGGGCAAGGCCATACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCCGTCTATTACTGTCAGGTTCAACTGCAGCAGTCTGGGGCT...GAGCTGGTGAGGCCTGGGGCTTCAGTGACGCTGTCCTGCAAGGCTTCGGGCTACACATTT............ACTGACTATGAAATGCACTGGGTGAAGCAGACACCTGTGCATGGCCTGGAATGGATTGGAGCTATTGATCCTGAA......ACTGGTGGTACTGCCTACAATCAGAAGTTCAAG...GGCAAGGCCATACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCCGTCTATTACTGT
IGHV-6JXW 12022-05-15IGHV9-1*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV9-1FMSM/MsJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAGAATATCCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTCAAGTGGATGGGCATGATATACACCGACACTGGAGAGCCAACATATGCTGAAGAGTTCAAGGGACGGTTTGCCTTCTCTTTGGAGACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACAGAATATCCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTCAAGTGGATGGGCATGATATACACCGAC......ACTGGAGAGCCAACATATGCTGAAGAGTTCAAG...GGACGGTTTGCCTTCTCTTTGGAGACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGT
IGHV-6XKZ 12022-05-15watson_et_al:MSM_MsJ_IGHV1-24FMSM/MsJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGATGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATCGGAGAGATTGATCCTTCTGATAGTTATACTAACTACAATCAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTTGTGATGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATCGGAGAGATTGATCCTTCT......GATAGTTATACTAACTACAATCAAAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGC
IGHV-724F 12022-05-15watson_et_al:MSM_MsJ_IGHV5-11FMSM/MsJGAAGTGATGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTATTACATGTCTTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCAGAAATTAGTAGTGGTGGTGGTAACACCTACTATCCAGACAGTGTGAAGGGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCTTGTATTACTGTGCAGAAGTGATGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTGACTATTACATGTCTTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCAGAAATTAGTAGTGGT......GGTGGTAACACCTACTATCCAGACAGTGTGAAG...GGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCTTGTATTACTGTGCA
IGHV-7EWH 12022-05-15IGHV1-75*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-28FMSM/MsJCAGGTCCAGCTACAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACCTTCACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTTTCCTGGAAGTGGTAGTACTTACTACAATGAGAAGTTCAAGGGCAAGGCCACACTTACTGTAGACAAATCCTCCAGCACAGCCTACATGTTGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTTCTGTCAGGTCCAGCTACAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACCTTC............ACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTTTCCTGGA......AGTGGTAGTACTTACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTTACTGTAGACAAATCCTCCAGCACAGCCTACATGTTGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTTCTGT
IGHV-ACUE 12022-05-15IGHV14-3*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV14-3FMSM/MsJGAGGTTCAGCTGCAGCAGTCTGTGGCAGAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAAACACCTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGCGAATGGTAATACTAAATATGCCCCGAAGTTCCAGGGCAAGGCCACTATAACTGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCATCTATTACTGTGCGAGGTTCAGCTGCAGCAGTCTGTGGCA...GAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAAACACCTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGCG......AATGGTAATACTAAATATGCCCCGAAGTTCCAG...GGCAAGGCCACTATAACTGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCATCTATTACTGTGC
IGHV-BT4P 12022-05-15IGHV1-12*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-1FMSM/MsJCAGGCTTATCTACAGCAGTCTGGGGCTGAGCTGGTGAGGCCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACATTTACCAGTTACAATATGCACTGGGTAAAGCAGACACCTAGACAGGGCCTGGAATGGATTGGAGCTATTTATCCAGGAAATGGTGATACTTCCTACAATCAGAAGTTCAAGGGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGACAGGCTTATCTACAGCAGTCTGGGGCT...GAGCTGGTGAGGCCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACATTT............ACCAGTTACAATATGCACTGGGTAAAGCAGACACCTAGACAGGGCCTGGAATGGATTGGAGCTATTTATCCAGGA......AATGGTGATACTTCCTACAATCAGAAGTTCAAG...GGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGA
IGHV-BWXT 12022-05-15IGHV1-54*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-15FMSM/MsJCAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTAAGGCCTGGGACTTCAGTGAAGGTGTCCTGCAAGGCTTCTGGATACGCCTTCACTAATTACTTGATAGAGTGGGTAAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAGTGATTAATCCTGGAAGTGGTGGTACTAACTACAATGAGAAGTTCAAGGGCAAGGCAACACTGACTGCAGACAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTCAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTAAGGCCTGGGACTTCAGTGAAGGTGTCCTGCAAGGCTTCTGGATACGCCTTC............ACTAATTACTTGATAGAGTGGGTAAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAGTGATTAATCCTGGA......AGTGGTGGTACTAACTACAATGAGAAGTTCAAG...GGCAAGGCAACACTGACTGCAGACAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGT
IGHV-BXDJ 12022-05-15IGHV1-74*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-27FMSM/MsJCAGGTCCAACTGCAGCAGCCTGGGGCTGAACTGGTGAAGCCTGGGGCTTCAGTGAAGGTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGCCAAGGCCTTGAGTGGATTGGAAGGATTCATCCTTCTGATAGTGATACTAACTACAATCAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTCAGGTCCAACTGCAGCAGCCTGGGGCT...GAACTGGTGAAGCCTGGGGCTTCAGTGAAGGTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGCCAAGGCCTTGAGTGGATTGGAAGGATTCATCCTTCT......GATAGTGATACTAACTACAATCAAAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGT
IGHV-CDKQ 12022-05-15IGHV5-15*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV5-5FMSM/MsJGAGGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTACGGAATGGCGTGGGTTCGACAGGCTCCAAGGAAGGGGCCTGAGTGGGTAGCATTCATTAGTAATTTGGCATATAGTATCTACTATGCAGACACTGTGACGGGCCGATTCACCATCTCTAGAGAGAATGCCAAGAACACCCTGTACCTGGAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGCAAGAGAGGTGAAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTGACTACGGAATGGCGTGGGTTCGACAGGCTCCAAGGAAGGGGCCTGAGTGGGTAGCATTCATTAGTAATTTG......GCATATAGTATCTACTATGCAGACACTGTGACG...GGCCGATTCACCATCTCTAGAGAGAATGCCAAGAACACCCTGTACCTGGAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGCAAGA
IGHV-DVNZ 12022-05-15IGHV7-1*01|Mus_musculus_C57BL/6,IGHV7-1*03|Mus_musculus_C57BL/10watson_et_al:MSM_MsJ_IGHV7-1FMSM/MsJGAGGTGAAGCTGGTGGAATCTGGAGGAGGCTTGGTACAGTCTGGGCGTTCTCTGAGACTCTCCTGTGCAACTTCTGGGTTCACCTTCAGTGATTTCTACATGGAGTGGGTCCGCCAAGCTCCAGGGAAGGGACTGGAGTGGATTGCTGCAAGTAGAAACAAAGCTAATGATTATACAACAGAGTACAGTGCATCTGTGAAGGGTCGGTTCATCGTCTCCAGAGACACTTCCCAAAGCATCCTCTACCTTCAGATGAATGCCCTGAGAGCTGAGGACACTGCCATTTATTACTGTGCAAGAGAGGTGAAGCTGGTGGAATCTGGAGGA...GGCTTGGTACAGTCTGGGCGTTCTCTGAGACTCTCCTGTGCAACTTCTGGGTTCACCTTC............AGTGATTTCTACATGGAGTGGGTCCGCCAAGCTCCAGGGAAGGGACTGGAGTGGATTGCTGCAAGTAGAAACAAAGCTAATGATTATACAACAGAGTACAGTGCATCTGTGAAG...GGTCGGTTCATCGTCTCCAGAGACACTTCCCAAAGCATCCTCTACCTTCAGATGAATGCCCTGAGAGCTGAGGACACTGCCATTTATTACTGTGCAAGA
IGHV-DYDA 12022-05-15watson_et_al:MSM_MsJ_IGHV2-6FMSM/MsJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCGTCTCAGGGTTCTCATTAACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGAGTGATGGAAGCACAACCTATAATTCAGCTCTCAAATCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTCCAAACTGATGACACAGCCATGTACTACTGTGCCACAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCGTCTCAGGGTTCTCATTA............ACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGAGTGAT.........GGAAGCACAACCTATAATTCAGCTCTCAAA...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTCCAAACTGATGACACAGCCATGTACTACTGTGCCA
IGHV-E5EW 12022-05-15IGHV1-61*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-19FMSM/MsJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTGGTGAGGCCTGGGTCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGGATTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAATGGATTGGTAACATTTACCCTTCTGATAGTGAAACTCACTACAATCAAAAGTTCAAGGACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTGGTGAGGCCTGGGTCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGGATTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAATGGATTGGTAACATTTACCCTTCT......GATAGTGAAACTCACTACAATCAAAAGTTCAAG...GACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGT
IGHV-ECGZ 12022-05-15watson_et_al:MSM_MsJ_IGHV2-9FMSM/MsJCAGGTACAACTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATTACCTGCACTGTCTCTGGGTTCTCATTAACCAGCTATGATATAAGCTGGATTCGCCAGCCACCAGGAAAGGGTCTGGAGTGGCTTGGAGTAATATGGACTGGTGGAGGCACAAATTATAATTCAGCTTTCATGTCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATATATTACTGTGTACAGGTACAACTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATTACCTGCACTGTCTCTGGGTTCTCATTA............ACCAGCTATGATATAAGCTGGATTCGCCAGCCACCAGGAAAGGGTCTGGAGTGGCTTGGAGTAATATGGACTGGT.........GGAGGCACAAATTATAATTCAGCTTTCATG...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATATATTACTGTGTA
IGHV-ED7H 12022-05-15IGHV8-5*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV8-3FMSM/MsJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTCTAATATGGGTATAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTAGAGTGGCTGGCACACATTTGGTGGAATGATGATAAGTACTATAACCCATCCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAACAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCAAACAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTCTAATATGGGTATAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTAGAGTGGCTGGCACACATTTGGTGGAAT.........GATGATAAGTACTATAACCCATCCCTGAAG...AGCCGGCTCACAATCTCCAAGGATACCTCCAACAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCAAA
IGHV-EH6M 12022-05-15IGHV1-64*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-22FMSM/MsJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTGGTAAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACTTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAATGATTCATCCTAATAGTGGTAGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTGGTAAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACTTTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAATGATTCATCCTAAT......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGT
IGHV-F3ON 12022-05-15IGHV7-3*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV7-2FMSM/MsJGAGGTGAAGCTGGTGGAGTCTGGAGGAGGCTTGGTACAGCCTGGGGGTTCTCTGAGTCTCTCCTGTGCAGCTTCTGGATTCACCTTCACTGATTACTACATGAGCTGGGTCCGCCAGCCTCCAGGGAAGGCACTTGAGTGGTTGGGTTTTATTAGAAACAAAGCTAATGGTTACACAACAGAGTACAGTGCATCTGTGAAGGGTCGGTTCACCATCTCCAGAGATAATTCCCAAAGCATCCTCTATCTTCAAATGAATGCCCTGAGAGCTGAGGACAGTGCCACTTATTACTGTGCAGAGGTGAAGCTGGTGGAGTCTGGAGGA...GGCTTGGTACAGCCTGGGGGTTCTCTGAGTCTCTCCTGTGCAGCTTCTGGATTCACCTTC............ACTGATTACTACATGAGCTGGGTCCGCCAGCCTCCAGGGAAGGCACTTGAGTGGTTGGGTTTTATTAGAAACAAAGCTAATGGTTACACAACAGAGTACAGTGCATCTGTGAAG...GGTCGGTTCACCATCTCCAGAGATAATTCCCAAAGCATCCTCTATCTTCAAATGAATGCCCTGAGAGCTGAGGACAGTGCCACTTATTACTGTGCA
IGHV-FCI2 12022-05-15IGHV6-6*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV6-2FMSM/MsJGAAGTGAAGCTTGAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCTTGTGCTGCCTCTGGATTCACTTTTAGTGACGCCTGGATGGACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTGAAATTAGAAACAAAGCTAATAATCATGCAACATACTATGCTGAGTCTGTGAAAGGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAGCTTAAGAGCTGAAGACACTGGCATTTATTACTGTGAAGTGAAGCTTGAGGAGTCTGGAGGA...GGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCTTGTGCTGCCTCTGGATTCACTTTT............AGTGACGCCTGGATGGACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTGAAATTAGAAACAAAGCTAATAATCATGCAACATACTATGCTGAGTCTGTGAAA...GGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAGCTTAAGAGCTGAAGACACTGGCATTTATTACTGT
IGHV-FFB3 12022-05-15IGHV15-2*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV15-1FMSM/MsJCAGGTTCACCTACAACAGTCTGGTTCTGAACTGAGGAGTCCTGGGTCTTCAGTAAAGCTGTCATGCAAGGATTTTGATTCAGAAGTCTTCCCTATTGCTTATATGAGTTGGGTAAGGCAGAAGCCTGGGCATGGATTTGAATGGATTGGAGGCATACTCCCAAGTATTGGTAGAACAATCTATGGAGAGAAGTTTGAGGACAAAGCCACATTGGATGCAGACACACTGTCCAACACAGCCTACTTGGAGCTCAACAGTCTGACATCCGAGGACTCTGCTATCTACTACTGTGCAAGGCAGGTTCACCTACAACAGTCTGGTTCT...GAACTGAGGAGTCCTGGGTCTTCAGTAAAGCTGTCATGCAAGGATTTTGATTCAGAAGTCTTC.........CCTATTGCTTATATGAGTTGGGTAAGGCAGAAGCCTGGGCATGGATTTGAATGGATTGGAGGCATACTCCCAAGT......ATTGGTAGAACAATCTATGGAGAGAAGTTTGAG...GACAAAGCCACATTGGATGCAGACACACTGTCCAACACAGCCTACTTGGAGCTCAACAGTCTGACATCCGAGGACTCTGCTATCTACTACTGTGCAAGG
IGHV-FPG7 12022-05-15watson_et_al:MSM_MsJ_IGHV5-1FMSM/MsJGAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCTTCTGGATTCACTTTCAGTAACTATTACATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAGAAATTAGTAGTGGTGGTGGTAGCACCTACTATCCAGACAGTGTGAAGGGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTCCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTGCAAGAAGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCTTCTGGATTCACTTTC............AGTAACTATTACATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAGAAATTAGTAGTGGT......GGTGGTAGCACCTACTATCCAGACAGTGTGAAG...GGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTCCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTGCAA
IGHV-G6NA 12022-05-15IGHV10-3*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV10-2FMSM/MsJGAGGTGCAGCTTGTTGAGTCTGGTGGAGGATTGGTGCAGCCTAAAGGATCATTGAAACTCTCATGTGCCGCCTCTGGTTTCACCTTCAATACCTATGCCATGCACTGGGTCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTAGTAATTATGCAACATATTATGCCGATTCAGTGAAAGACAGATTCACCATCTCCAGAGATGATTCACAAAGCATGCTCTATCTGCAAATGAACAACCTGAAAACTGAGGACACAGCCATGTATTACTGTGTGAGGTGCAGCTTGTTGAGTCTGGTGGA...GGATTGGTGCAGCCTAAAGGATCATTGAAACTCTCATGTGCCGCCTCTGGTTTCACCTTC............AATACCTATGCCATGCACTGGGTCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTAGTAATTATGCAACATATTATGCCGATTCAGTGAAA...GACAGATTCACCATCTCCAGAGATGATTCACAAAGCATGCTCTATCTGCAAATGAACAACCTGAAAACTGAGGACACAGCCATGTATTACTGTGT
IGHV-GDIS 12022-05-15IGHV13-2*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV13-1FMSM/MsJCAGGTGCAGCTTGTAGAGACCGGGGGAGGCTTGGTGAGGCCTGGAAATTCTCTGAAACTCTCCTGTGTTACCTCGGGATTCACTTTCAGTAACTACCGGATGCACTGGCTTCGCCAGCCTCCAGGGAAGAGGCTGGAGTGGATTGCTGTAATTACAGTCAAATCTGATAATTATGGAGCAAATTATGCAGAGTCTGTGAAAGGCAGATTCGCCATTTCAAGAGATGATTCAAAAAGCAGTGTCTACCTAGAGATGAACAGATTAAGAGAGGAAGACACTGCCACTTATTTTTGTAGTCAGGTGCAGCTTGTAGAGACCGGGGGA...GGCTTGGTGAGGCCTGGAAATTCTCTGAAACTCTCCTGTGTTACCTCGGGATTCACTTTC............AGTAACTACCGGATGCACTGGCTTCGCCAGCCTCCAGGGAAGAGGCTGGAGTGGATTGCTGTAATTACAGTCAAATCTGATAATTATGGAGCAAATTATGCAGAGTCTGTGAAA...GGCAGATTCGCCATTTCAAGAGATGATTCAAAAAGCAGTGTCTACCTAGAGATGAACAGATTAAGAGAGGAAGACACTGCCACTTATTTTTGTAGT
IGHV-GUKT 12022-05-15watson_et_al:MSM_MsJ_IGHV14-2FMSM/MsJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAGACTACTATATGCACTGGGTGAAGCAGAGGACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATATGCCCCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAGACTACTATATGCACTGGGTGAAGCAGAGGACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAG......GATGGTGAAACTAAATATGCCCCGAAGTTCCAG...GGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTG
IGHV-GX2P 12022-05-15watson_et_al:MSM_MsJ_IGHV2-7FMSM/MsJCAAGTGCAGATGAAGGAGTCAGGACCTGACCTTGTGCAGCCATCACAGACTCTGTCTCTCACCTGCACTGTCTCTGGGTTCTCATTAAGTAGCTATGGTGTACATTGGTTTCGCAAGCCTCCGAGAAAGGGATTGGAATGGTTGGGAGGAATATGGTCTGGTGGAAGCATATACTATACTCCAGCTCTCAGTTCCCGACTGAGTGTCAGCAGGGACATCTCTAAGAGCCAAGTTTTCTTTAAAATGAGCAGTCTGCAAAGTGAAGACACGGCTGTGTACCACTGTGCCAGATACAAGTGCAGATGAAGGAGTCAGGACCT...GACCTTGTGCAGCCATCACAGACTCTGTCTCTCACCTGCACTGTCTCTGGGTTCTCATTA............AGTAGCTATGGTGTACATTGGTTTCGCAAGCCTCCGAGAAAGGGATTGGAATGGTTGGGAGGAATATGGTCTGGT.........GGAAGCATATACTATACTCCAGCTCTCAGT...TCCCGACTGAGTGTCAGCAGGGACATCTCTAAGAGCCAAGTTTTCTTTAAAATGAGCAGTCTGCAAAGTGAAGACACGGCTGTGTACCACTGTGCCAGATA
IGHV-GXHA 12022-05-15IGHV1-50*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-12FMSM/MsJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCAGTGGGTAAAACAGAGGCCTGGACAGGGCCTTGAGTGGATCGGAGAGATTGATCCTTCTGATAGCTATACTAACTACAATCAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCAGTGGGTAAAACAGAGGCCTGGACAGGGCCTTGAGTGGATCGGAGAGATTGATCCTTCT......GATAGCTATACTAACTACAATCAAAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGC
IGHV-HD6C 12022-05-15IGHV1-55*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-16FMSM/MsJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATAACCTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGATATTTATCCTGGTAGTGGTAGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCACAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATAACCTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGATATTTATCCTGGT......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCA
IGHV-HFF6 12022-05-15watson_et_al:MSM_MsJ_IGHV2-3FMSM/MsJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCATCTCAGGGTTCTCATTAACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGTAGTGATATGGAGTGATGAAAGCACAACCTATAATTCAGCTCTCAAATCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCAGACACAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCATCTCAGGGTTCTCATTA............ACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGTAGTGATATGGAGTGAT.........GAAAGCACAACCTATAATTCAGCTCTCAAA...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCAGACA
IGHV-HGG2 12022-05-15IGHV8-2*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV8-2FMSM/MsJCAGGTTACTCTGAAAGTGTCTGGCCCTGGGATATTGCAGCCATCACAGACTCTCAGCCTGGCCTGTACTTTCTCTGGGATTTCACTGAGTACTTCTGGTATGGGTTTGAGCTGGCTTCGTAAGCCCTCAGGGAAGGCTTTAGAGTGGCTGGCAAGCATTTGGAATAATGATAACTACTACAACCCATCTTTGAAGAGCCGGCTCACAATCTCCAAGGAGACCTCCAACTACCAAGTATTCCTTAAACTCACCAGTGTGGACACTGCAGATTCTGCCACATACTACGGTGCTTGGAGAGCAGGTTACTCTGAAAGTGTCTGGCCCT...GGGATATTGCAGCCATCACAGACTCTCAGCCTGGCCTGTACTTTCTCTGGGATTTCACTGAGT......ACTTCTGGTATGGGTTTGAGCTGGCTTCGTAAGCCCTCAGGGAAGGCTTTAGAGTGGCTGGCAAGCATTTGGAAT............AATGATAACTACTACAACCCATCTTTGAAG...AGCCGGCTCACAATCTCCAAGGAGACCTCCAACTACCAAGTATTCCTTAAACTCACCAGTGTGGACACTGCAGATTCTGCCACATACTACGGTGCTTGGAGAG
IGHV-HQQK 12022-05-15watson_et_al:MSM_MsJ_IGHV5-10FMSM/MsJGAAGTGAAGCTCGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGCCATGTCTTGGGTTCGCCAGTCTCCAGAGAAGAGGCTGGAGTGGGTCGCAGAAATTAGTAGTGGTGGTAGTTACACCTACTATCCAGACAGTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCTTGTATTACTGTGCAGAAGTGAAGCTCGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATGCCATGTCTTGGGTTCGCCAGTCTCCAGAGAAGAGGCTGGAGTGGGTCGCAGAAATTAGTAGTGGT......GGTAGTTACACCTACTATCCAGACAGTGTGAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCTTGTATTACTGTGCA
IGHV-I35M 12022-05-15IGHV1-63*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-21FMSM/MsJCAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTAAGGCCTGGGACTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACCTTCACTAACTACTGGATAGGTTGGGCAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGATATTTACCCTGGAGGTGGTTATACTAACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGTTCAGCAGCCTGACATCTGAGGACTCTGCCATCTATTACTGTCAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTAAGGCCTGGGACTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACCTTC............ACTAACTACTGGATAGGTTGGGCAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGATATTTACCCTGGA......GGTGGTTATACTAACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGTTCAGCAGCCTGACATCTGAGGACTCTGCCATCTATTACTGT
IGHV-IG7Z 12022-05-15IGHV1-39*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-8FMSM/MsJGAGTTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGCGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGACTACAACATGAACTGGGTGAAGCAGAGCAATGGAAAGAGCCTTGAGTGGATTGGAGTAATTAATCCTAACTATGGTACTACTAGCTACAATCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACCAATCTTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCGAGTTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGCGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTC............ACTGACTACAACATGAACTGGGTGAAGCAGAGCAATGGAAAGAGCCTTGAGTGGATTGGAGTAATTAATCCTAAC......TATGGTACTACTAGCTACAATCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACCAATCTTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGC
IGHV-IZIY 12022-05-15IGHV1-84*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-35FMSM/MsJCAGATCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACCTTCACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTGGAAGCGGTAATACTAAGTACAATGAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTTCTGTGCAAGCAGATCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACCTTC............ACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTGGA......AGCGGTAATACTAAGTACAATGAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTTCTGTGCAAG
IGHV-JPJZ 12022-05-15watson_et_al:MSM_MsJ_IGHV5-4FMSM/MsJGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAACTATTACATGTATTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCATACATTAGTAGTGGTGGTGGTAGCACCTACTATCCAGACACTGTAAAGGGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACCTGGCCATGTATTACTGTGCAAGAGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAACTATTACATGTATTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCATACATTAGTAGTGGT......GGTGGTAGCACCTACTATCCAGACACTGTAAAG...GGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACCTGGCCATGTATTACTGTGCAAGA
IGHV-L5FH 12022-05-15watson_et_al:MSM_MsJ_IGHV2-11FMSM/MsJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACTTGCACTGTCTCTGGGTTTTCATTAACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGGTGGAAGCACAAATTATAATTCAGCTCTCATGTCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACTTGCACTGTCTCTGGGTTTTCATTA............ACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGGT.........GGAAGCACAAATTATAATTCAGCTCTCATG...TCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGC
IGHV-LPGR 12022-05-15IGHV1-5*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-11FMSM/MsJGAGGTTCAGCTCCAGCAGTCTGGGACTGTGCTGGCAAGGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGACTTCTGGCTACACATTTACCAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATAGGGGCTATTTATCCTGGAAATAGTGATACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCAAACTGACTGCAGTCACATCCGCCAGCACTGCCTACATGGAGCTCAGCAGCCTGACAAATGAGGACTCTGCGGTCTATTACTGTGAGGTTCAGCTCCAGCAGTCTGGGACT...GTGCTGGCAAGGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGACTTCTGGCTACACATTT............ACCAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATAGGGGCTATTTATCCTGGA......AATAGTGATACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCAAACTGACTGCAGTCACATCCGCCAGCACTGCCTACATGGAGCTCAGCAGCCTGACAAATGAGGACTCTGCGGTCTATTACTGT
IGHV-LZ4V 12022-05-15IGHV1-78*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-31FMSM/MsJCAGGTTCAGCTGCAACAGTCTGACGCTGAGTTGGTGAAACCTGGAGCTTCAGTGAAGATATCCTGCAAGGTTTCTGGCTACACCTTCACTGACCATACTATTCACTGGATGAAGCAGAGGCCTGAACAGGGCCTGGAATGGATTGGATATATTTATCCTAGAGATGGTAGTACTAAGTACAATGAGAAGTTCAAGGGCAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCCAGGTTCAGCTGCAACAGTCTGACGCT...GAGTTGGTGAAACCTGGAGCTTCAGTGAAGATATCCTGCAAGGTTTCTGGCTACACCTTC............ACTGACCATACTATTCACTGGATGAAGCAGAGGCCTGAACAGGGCCTGGAATGGATTGGATATATTTATCCTAGA......GATGGTAGTACTAAGTACAATGAGAAGTTCAAG...GGCAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGC
IGHV-LZPN 12022-05-15IGHV3-6*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV3-1FMSM/MsJGATGTACAGCTTCAGGAGTCAGGACCTGGCCTCGTGAAACCTTCTCAGTCTCTGTCTCTCACCTGCTCTGTCACTGGCTACTCCATCACCAGTGGTTATTACTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAATGGATGGGCTACATAAGCTACGATGGTAGCAATAACTACAACCCATCTCTCAAAAATCGAATCTCCATCACTCGTGACACATCTAAGAACCAGTTTTTCCTGAAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGATGTACAGCTTCAGGAGTCAGGACCT...GGCCTCGTGAAACCTTCTCAGTCTCTGTCTCTCACCTGCTCTGTCACTGGCTACTCCATCACC.........AGTGGTTATTACTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAATGGATGGGCTACATAAGCTACGAT.........GGTAGCAATAACTACAACCCATCTCTCAAA...AATCGAATCTCCATCACTCGTGACACATCTAAGAACCAGTTTTTCCTGAAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGT
IGHV-MM42 12022-05-15watson_et_al:MSM_MsJ_IGHV2-8FMSM/MsJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCTGGGTTCTCATTAACCAGCTATGCTATAAGCTGGGTTCGCCAGCCACCAGGAAAGGGTCTGGAGTGGCTTGGAGTAATATGGACTGGTGGAGGCACAAATTATAATTCAGCTCTCAAATCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGTCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCACGTACTACTGTGCCCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCTGGGTTCTCATTA............ACCAGCTATGCTATAAGCTGGGTTCGCCAGCCACCAGGAAAGGGTCTGGAGTGGCTTGGAGTAATATGGACTGGT.........GGAGGCACAAATTATAATTCAGCTCTCAAA...TCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGTCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCACGTACTACTGTGCC
IGHV-MQ2W 12022-05-15IGHV1-80*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-32FMSM/MsJCAGGTTCAGCTGCAGCAGTCTGGGGCTGAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAAGCTTCTGGCTACGCATTCAGTAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGAAAGGGTCTTGAGTGGATTGGACAGATTTATCCTGGAGATGGTGATACTAACTACAACGGAAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTTCTGTGCCAGGTTCAGCTGCAGCAGTCTGGGGCT...GAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAAGCTTCTGGCTACGCATTC............AGTAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGAAAGGGTCTTGAGTGGATTGGACAGATTTATCCTGGA......GATGGTGATACTAACTACAACGGAAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTTCTGTGC
IGHV-N46H 12022-05-15watson_et_al:MSM_MsJ_IGHV14-1FMSM/MsJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAGGCCAGGGACCTCAGTCAAGTTGTCCTGCAAAGCTTCTGGCTTCAACATTAAAGACTACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGAATGGTAATACTATATATGACCCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAGGCCAGGGACCTCAGTCAAGTTGTCCTGCAAAGCTTCTGGCTTCAACATT............AAAGACTACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAG......AATGGTAATACTATATATGACCCGAAGTTCCAG...GGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGT
IGHV-NDA5 12022-05-15IGHV1-81*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-33FMSM/MsJCAGGTTCAGCTGCAGCAGTCTGGAGCTGAGCTGGCGAGGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACAAGCTATGGTATAAGCTGGGTGAAGCAGAGAACTGGACAGGGCCTTGAGTGGATTGGAGAGATTTATCCTAGAAGTGGTAATACTTACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCGTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTCAGGTTCAGCTGCAGCAGTCTGGAGCT...GAGCTGGCGAGGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACAAGCTATGGTATAAGCTGGGTGAAGCAGAGAACTGGACAGGGCCTTGAGTGGATTGGAGAGATTTATCCTAGA......AGTGGTAATACTTACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCGTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGT
IGHV-NFUY 12022-05-15watson_et_al:MSM_MsJ_IGHV5-3FMSM/MsJGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAACTATTACATGTATTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCAGAAATTAGTAGTGGTGGTGGTAGCAACTACTATCCAGACACTGTAAAGGGGCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGCAAGGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAACTATTACATGTATTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCAGAAATTAGTAGTGGT......GGTGGTAGCAACTACTATCCAGACACTGTAAAG...GGGCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGCAAG
IGHV-NLDH 12022-05-15IGHV9-2*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV9-2FMSM/MsJCAGATCCAGTTCGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGTGTATACCTTCACAGAATATCCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTCAAGTGGATGGGCTGGATAAACACCTACTCTGGAGAGCCAACATATGCTGACGACTTCAAGGGACGGTTTGCCTTTTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCCAGATCCAGTTCGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGTGTATACCTTC............ACAGAATATCCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTCAAGTGGATGGGCTGGATAAACACCTAC......TCTGGAGAGCCAACATATGCTGACGACTTCAAG...GGACGGTTTGCCTTTTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGC
IGHV-OAN5 12022-05-15IGHV12-3*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV12-1FMSM/MsJCAGATGCAGCTTCAGGAGTCAGGACCTGGCCTGGTGAAACCCTCACAGTCACTCTTCCTTACCTGCTCTATTACTGGTTTCCCCATCACCAGTGGTTACTACTGGATCTGGATCCGTCAGTCACCTGGGAAACCCCTAGAATGGATGGGGTACATCACTCATAGTGGGGAAACTTTCTACAACCCATCTCTCCAGAGCCCCATCTCCATTACTAGAGAAACGTCAAAGAACCAGTTCTTCCTCCAATTGAACTCTGTGACCACAGAGGACACAGCCATGTATTACTGTGCAGGAGACCAGATGCAGCTTCAGGAGTCAGGACCT...GGCCTGGTGAAACCCTCACAGTCACTCTTCCTTACCTGCTCTATTACTGGTTTCCCCATCACC.........AGTGGTTACTACTGGATCTGGATCCGTCAGTCACCTGGGAAACCCCTAGAATGGATGGGGTACATCACTCATAGT.........GGGGAAACTTTCTACAACCCATCTCTCCAG...AGCCCCATCTCCATTACTAGAGAAACGTCAAAGAACCAGTTCTTCCTCCAATTGAACTCTGTGACCACAGAGGACACAGCCATGTATTACTGTGCAGGAGAC
IGHV-QLDU 12022-05-15IGHV1-42*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-9FMSM/MsJGAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGGCTACTACATGAACTGGGTGAAGCAAAGTCCTGAAAAGAGCCTTGAGTGGATTGGAGAGATTAATCCTAGCACTGGTGGTACTACCTACAACCAGAAGTTCAAGGCCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAAGAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGAGAGGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTC............ACTGGCTACTACATGAACTGGGTGAAGCAAAGTCCTGAAAAGAGCCTTGAGTGGATTGGAGAGATTAATCCTAGC......ACTGGTGGTACTACCTACAACCAGAAGTTCAAG...GCCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAAGAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGA
IGHV-QZEY 12022-05-15IGHV1-52*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-13FMSM/MsJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTGGTGAGGCCTGGGTCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCATTGGGTGAAGCAGAGGCCTATACAAGGCCTTGAATGGATTGGTAACATTGACCCTTCTGATAGTGAAACTCACTACAATCAAAAGTTCAAGGACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTGGTGAGGCCTGGGTCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCATTGGGTGAAGCAGAGGCCTATACAAGGCCTTGAATGGATTGGTAACATTGACCCTTCT......GATAGTGAAACTCACTACAATCAAAAGTTCAAG...GACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGT
IGHV-ROLQ 12022-05-15IGHV1-82*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-34FMSM/MsJCAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAGGCTTCTGGCTACGCATTCAGTAGCTCCTGGATGAACTGGGTGAAGCAGAGGCCTGGAAAGGGTCTTGAGTGGATTGGACGGATTTATCCTGGAGATGGAGATACTAACTACAATGGGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTACTTCTGTGCCAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAGGCTTCTGGCTACGCATTC............AGTAGCTCCTGGATGAACTGGGTGAAGCAGAGGCCTGGAAAGGGTCTTGAGTGGATTGGACGGATTTATCCTGGA......GATGGAGATACTAACTACAATGGGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTACTTCTGTGC
IGHV-RRWL 12022-05-15watson_et_al:MSM_MsJ_IGHV5-7FMSM/MsJGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAACTATGGAATGCACTGGGTTCGTCAGGCTCCAGAGAAGGGGCTGGAGTGGGTTGCATACATTAGTAGTGGCAGTAGTACCATCTACTATGCAGACACAGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTTCCTGCAAATGACCAGTCTAAGGTCTGAGGACACGGCCATGTATTACTGTGCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAACTATGGAATGCACTGGGTTCGTCAGGCTCCAGAGAAGGGGCTGGAGTGGGTTGCATACATTAGTAGTGGC......AGTAGTACCATCTACTATGCAGACACAGTGAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTTCCTGCAAATGACCAGTCTAAGGTCTGAGGACACGGCCATGTATTACTGTGC
IGHV-RSWU 12022-05-15IGHV1-31*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-7FMSM/MsJGAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGGCTACTACATGCACTGGGTGAAGCAGAGCCATGGAAATATCCTCGATTGGATTGGATATATTTATCCTTACAATGGTGTTTCTAGCTACAACCAGAAATTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCTAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAGAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTC............ACTGGCTACTACATGCACTGGGTGAAGCAGAGCCATGGAAATATCCTCGATTGGATTGGATATATTTATCCTTAC......AATGGTGTTTCTAGCTACAACCAGAAATTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCTAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCA
IGHV-S2VX 12022-05-15IGHV1-59*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-18FMSM/MsJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTGGTGAGGCCTGGGACTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTAAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATCGGAGTGATTGATCCTTCTGATAGTTATACTAACTACAATCAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTGGTGAGGCCTGGGACTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCACTGGGTAAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATCGGAGTGATTGATCCTTCT......GATAGTTATACTAACTACAATCAAAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGC
IGHV-SAXO 12022-05-15IGHV10-1*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV10-1FMSM/MsJGAGGTGCAGCTTGTTGAGTCTGGTGGAGGATTGGTGCAGCCTAAAGGGTCATTGAAACTCTCATGTGCAGCCTCTGGATTCAGCTTCAATACCTACGCCATGAACTGGGTCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTAATAATTATGCAACATATTATGCCGATTCAGTGAAAGACAGATTCACCATCTCCAGAGATGATTCAGAAAGCATGCTCTATCTGCAAATGAACAACTTGAAAACTGAGGACACAGCCATGTATTACTGTGGAGGTGCAGCTTGTTGAGTCTGGTGGA...GGATTGGTGCAGCCTAAAGGGTCATTGAAACTCTCATGTGCAGCCTCTGGATTCAGCTTC............AATACCTACGCCATGAACTGGGTCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTAATAATTATGCAACATATTATGCCGATTCAGTGAAA...GACAGATTCACCATCTCCAGAGATGATTCAGAAAGCATGCTCTATCTGCAAATGAACAACTTGAAAACTGAGGACACAGCCATGTATTACTGTG
IGHV-SEGR 12022-05-15IGHV1-72*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-26FMSM/MsJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAATAGTGGTGGTACTAAGTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTGCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAAT......AGTGGTGGTACTAAGTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACAAACCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTG
IGHV-SPXV 12022-05-15IGHV1-26*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-6FMSM/MsJGAGGTCCAGCTGCAACAATCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGTAAGGCTTCTGGATACACGTTCACTGACTACTACATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAACAATGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGAGGTCCAGCTGCAACAATCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGTAAGGCTTCTGGATACACGTTC............ACTGACTACTACATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAAC......AATGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGT
IGHV-TTLL 12022-05-15IGHV1-47*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-10FMSM/MsJCAGGTTCAGCTGCAGCAGTCTGGGGCTGAGCTAGTGAAGCCTGGAGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTCACTACCTATCCTATAGAGTGGATGAAGCAGAATCATGGAAAGAGCCTAGAGTGGATTGGAAATTTTCATCCTTACAATGATGATACTAAGTACAATGAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGAAAAATCCTCTAGCACAGTCTACTTGGAGCTCAGCCGATTAACATCTGATGACTCTGCTGTTTATTACTGTGCAACAGGTTCAGCTGCAGCAGTCTGGGGCT...GAGCTAGTGAAGCCTGGAGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTC............ACTACCTATCCTATAGAGTGGATGAAGCAGAATCATGGAAAGAGCCTAGAGTGGATTGGAAATTTTCATCCTTAC......AATGATGATACTAAGTACAATGAAAAGTTCAAG...GGCAAGGCCACATTGACTGTAGAAAAATCCTCTAGCACAGTCTACTTGGAGCTCAGCCGATTAACATCTGATGACTCTGCTGTTTATTACTGTGCAA
IGHV-U6BF 12022-05-15watson_et_al:MSM_MsJ_IGHV2-2FMSM/MsJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCATCTCAGGGTTCTCATTAACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGTAGTGATATGGAGTGATGGAAGCACAGCCTATAATTCACCTCTCAAATCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAATTTTCTTAAAAATGAACAGTCTCCAAACTGATGACACAGCCATGTACTACTGTGCCAGCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCATCTCAGGGTTCTCATTA............ACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGTAGTGATATGGAGTGAT.........GGAAGCACAGCCTATAATTCACCTCTCAAA...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAATTTTCTTAAAAATGAACAGTCTCCAAACTGATGACACAGCCATGTACTACTGTGCCAG
IGHV-U7SL 12022-05-15watson_et_al:MSM_MsJ_IGHV5-2FMSM/MsJGAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATTACATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCATACATTAGTAGTGGTGGTGGTAGCACCTACTATCCAGACAGTGTAAAGGGCCGATTCACCATCTCCAGAGACAATGCCAGGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACGGCCATGTATTACTGTGCAAGAAGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATTACATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCATACATTAGTAGTGGT......GGTGGTAGCACCTACTATCCAGACAGTGTAAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAGGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACGGCCATGTATTACTGTGCAA
IGHV-ULSZ 12022-05-15watson_et_al:MSM_MsJ_IGHV5-9FMSM/MsJGAAGTGATGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGACATGTCTTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTTGGTCGCAGCCATTAATAGTAATGGTGGTAGCACCTACTATCCAGACACTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCTTGTATTACTGTGCAGAAGTGATGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATGACATGTCTTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTTGGTCGCAGCCATTAATAGTAAT......GGTGGTAGCACCTACTATCCAGACACTGTGAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCTTGTATTACTGTGCA
IGHV-UTEO 12022-05-15watson_et_al:MSM_MsJ_IGHV2-5FMSM/MsJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCTGGGTTCTCATTAACCAGCTATGGTGTAGACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGTTGGAAGCACAAATTATAATTCAGCTCTCAAATCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCAGCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCTGGGTTCTCATTA............ACCAGCTATGGTGTAGACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGTT.........GGAAGCACAAATTATAATTCAGCTCTCAAA...TCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCAG
IGHV-UYAZ 12022-05-15watson_et_al:MSM_MsJ_IGHV11-2FMSM/MsJGAAGTGCAGCTGTTGGAGACTGGAGGAGGCTTGGTGCAACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTTAGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGATGGCAGTGCAATAAACTACGCACCATCCATAAAGGATCGATTCACTATCTTCAGAGACAATGACAAAAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCTGAGGACACAGCCACGTATTTCTGTGAAGTGCAGCTGTTGGAGACTGGAGGA...GGCTTGGTGCAACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTT............AGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGAT......GGCAGTGCAATAAACTACGCACCATCCATAAAG...GATCGATTCACTATCTTCAGAGACAATGACAAAAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCTGAGGACACAGCCACGTATTTCTGT
IGHV-V2PN 12022-05-15IGHV1-9*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-37FMSM/MsJCAGGTTCAGCTGCAGCAGTCTGGAGCTGAGCTGATGAAGCCTGGGGCCTCAGTGAAGCTTTCCTGCAAGGCTACTGGCTACACATTCACTGGCTACTGGATAGAGTGGGTAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGAGATTTTACCTGGAAGTGGTAGTACTAACTACAATGAGAAGTTCAAGGGCAAGGCCACATTCACTGCAGATACATCCTCCAACACAGCCTACATGCAACTCAGCAGCCTGACAACTGAGGACTCTGCCATCTATTACTGTGCCAGGTTCAGCTGCAGCAGTCTGGAGCT...GAGCTGATGAAGCCTGGGGCCTCAGTGAAGCTTTCCTGCAAGGCTACTGGCTACACATTC............ACTGGCTACTGGATAGAGTGGGTAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGAGATTTTACCTGGA......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...GGCAAGGCCACATTCACTGCAGATACATCCTCCAACACAGCCTACATGCAACTCAGCAGCCTGACAACTGAGGACTCTGCCATCTATTACTGTGC
IGHV-VB4F 12022-05-15IGHV1-7*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-25FMSM/MsJCAGGTCCAGCTGCAGCAGTCTGGGGCTGAACTGGCAAAACCTGGGGCCTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTTACTAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGCAGTGGTTATACTAAGTACAATCAGAAGTTCAAGGACAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTGAGCAGCCTGACATATGAGGACTCTGCAGTCTATTACTGTGCAAGACAGGTCCAGCTGCAGCAGTCTGGGGCT...GAACTGGCAAAACCTGGGGCCTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTT............ACTAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGC......AGTGGTTATACTAAGTACAATCAGAAGTTCAAG...GACAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTGAGCAGCCTGACATATGAGGACTCTGCAGTCTATTACTGTGCAAGA
IGHV-VDQ4 12022-05-15IGHV5-16*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV5-6FMSM/MsJGAAGTGAAGCTGGTGGAGTCTGAGGGAGGCTTAGTGCAGCCTGGAAGTTCCATGAAACTCTCCTGCACAGCCTCTGGATTCACTTTCAGTGACTATTACATGGCTTGGGTCCGCCAGGTTCCAGAAAAGGGTCTAGAATGGGTTGCAAACATTAATTATGATGGTAGTAGCACCTACTATCTGGACTCCTTGAAGAGCCGTTTCATCATCTCGAGAGACAATGCAAAGAACATTCTATACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCACGTATTACTGTGCGAAGTGAAGCTGGTGGAGTCTGAGGGA...GGCTTAGTGCAGCCTGGAAGTTCCATGAAACTCTCCTGCACAGCCTCTGGATTCACTTTC............AGTGACTATTACATGGCTTGGGTCCGCCAGGTTCCAGAAAAGGGTCTAGAATGGGTTGCAAACATTAATTATGAT......GGTAGTAGCACCTACTATCTGGACTCCTTGAAG...AGCCGTTTCATCATCTCGAGAGACAATGCAAAGAACATTCTATACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCACGTATTACTGTGC
IGHV-VE3A 12022-05-15IGHV1-62-2*01|Mus_musculus_C57BL/6,IGHV1-71*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-20FMSM/MsJCAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTGAAACCCGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACTGAGTATACTATACACTGGGTAAAGCAGAGGTCTGGACAGGGTCTTGAGTGGATTGGGTGGTTTTACCCTGGAAGTGGTAGTATAAAGTACAATGAGAAATTCAAGGACAAGGCCACATTGACTGCGGACAAATCCTCCAGCACAGTCTATATGGAGCTTAGTAGATTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGACCAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTGAAACCCGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACTGAGTATACTATACACTGGGTAAAGCAGAGGTCTGGACAGGGTCTTGAGTGGATTGGGTGGTTTTACCCTGGA......AGTGGTAGTATAAAGTACAATGAGAAATTCAAG...GACAAGGCCACATTGACTGCGGACAAATCCTCCAGCACAGTCTATATGGAGCTTAGTAGATTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGAC
IGHV-VRCT 12022-05-15IGHV11-2*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV11-1FMSM/MsJGAAGTGCAGCTGTTGGAGACTGGAGGAGGCTTGGTGCAACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTTAGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGATGGCAGTGCAATAAACTACGCACCATCCATAAAGGATCGATTCACTATCTTCAGAGACAATGACAAGAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCGGAGGACACAGCCACGTATTTCTGTGAAGTGCAGCTGTTGGAGACTGGAGGA...GGCTTGGTGCAACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTT............AGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGAT......GGCAGTGCAATAAACTACGCACCATCCATAAAG...GATCGATTCACTATCTTCAGAGACAATGACAAGAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCGGAGGACACAGCCACGTATTTCTGT
IGHV-WTC5 12022-05-15IGHV2-4-1*01|Mus_musculus_129/Svwatson_et_al:MSM_MsJ_IGHV2-1FMSM/MsJCAGGTGCAGCTGAAGCAGTCAGGACCTGGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTAACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGTGGAAGCACAGACTATAATGCAGCTTTCATATCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATACTACTGTGCCCAGGTGCAGCTGAAGCAGTCAGGACCT...GGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTA............ACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGT.........GGAAGCACAGACTATAATGCAGCTTTCATA...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATACTACTGTGCC
IGHV-XWKM 12022-05-15watson_et_al:MSM_MsJ_IGHV5-8FMSM/MsJGAAGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAAACTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATTACATGTCTTGGGTTCGCCAGACTCCGGAAAAGAGGCTGGAGTGGGTCGCAACCATTAGTGATGGTGGTAGTTACACCTACTATCCAGACAGTGTAAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACCTGGCCATGTATTACTGTGCAAGGAAGTGAAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAAACTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATTACATGTCTTGGGTTCGCCAGACTCCGGAAAAGAGGCTGGAGTGGGTCGCAACCATTAGTGATGGT......GGTAGTTACACCTACTATCCAGACAGTGTAAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACCTGGCCATGTATTACTGTGCAAG
IGHV-YJAL 12022-05-15watson_et_al:MSM_MsJ_IGHV2-4FMSM/MsJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCTCTGTCTCTGGTTTCTCACTAACCAACTCTGGTGTACACTGGGTTCGCCAGCCTCCAAGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGATGGAAGCACAAATTATAATTCAGCTCTCAAATCCAGACTGAGAATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCTCTGTCTCTGGTTTCTCACTA............ACCAACTCTGGTGTACACTGGGTTCGCCAGCCTCCAAGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGAT.........GGAAGCACAAATTATAATTCAGCTCTCAAA...TCCAGACTGAGAATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCC
IGHV-YU7L 12022-05-15IGHV1-22*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-5FMSM/MsJGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTGACTACAACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTAACCCTAACAATGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAAACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCGGAGGATTCTGCAGTCTATTACTGTGCGAGGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACAACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTAACCCTAAC......AATGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAAACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCGGAGGATTCTGCAGTCTATTACTGTGC
IGHV-YUES 12022-05-15IGHV14-4*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV14-4FMSM/MsJGAGGTTCAGCTGCAGCAGTCTGGGGCTGAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTTAACATTAAAGACGACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAGAATGGTGATACTGAATATGCCTCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTACGAGGTTCAGCTGCAGCAGTCTGGGGCT...GAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTTAACATT............AAAGACGACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAG......AATGGTGATACTGAATATGCCTCGAAGTTCCAG...GGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTAC
IGHV-YWSQ 12022-05-15IGHV8-8*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV8-4FMSM/MsJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTTTGGTATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGGATGATGATAAGTACTATAACCCAGCCCTGAAGAGTCGGCTCACAATCTCCAAGGATACCTCCAAAAACCAGGTATTCCTCAAGATCGCCAATGTGGACACTGCAGATACTGCCACATACTACTGTGCTCGACAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTTTGGTATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGGAT.........GATGATAAGTACTATAACCCAGCCCTGAAG...AGTCGGCTCACAATCTCCAAGGATACCTCCAAAAACCAGGTATTCCTCAAGATCGCCAATGTGGACACTGCAGATACTGCCACATACTACTGTGCTCGA
IGHV-Z2FG 12022-05-15IGHV1-85*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-36FMSM/MsJCAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTCACAAGCTACGATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTAGAGATGGTAGTACTAAGTACAATGAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCGTACATGGAGCTCCACAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCCAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACAAGCTACGATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTAGA......GATGGTAGTACTAAGTACAATGAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCGTACATGGAGCTCCACAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGC
IGHV-ZCV3 12022-05-15IGHV9-4*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV9-4FMSM/MsJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAACTGCTGGAATGCAGTGGGTGCAAAAGATGCCAGGAAAGGGTTTTAAGTGGATTGGCTGGATAAACACCCACTCTGGAGAGCCAAAATATGCAGAAGACTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTACAGATAAGCAACCTCAAAAATGAGGACACGGCTACGTATTTCTGTGCCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACAACTGCTGGAATGCAGTGGGTGCAAAAGATGCCAGGAAAGGGTTTTAAGTGGATTGGCTGGATAAACACCCAC......TCTGGAGAGCCAAAATATGCAGAAGACTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTACAGATAAGCAACCTCAAAAATGAGGACACGGCTACGTATTTCTGTGC
IGHV-ZQBW 12022-05-15IGHV9-3*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV9-3FMSM/MsJCAGATCCAGTTGGTACAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAACCTATGGAATGAGCTGGGTGAAACAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCTACTCTGGAGTGCCAACATATGCTGATGACTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCCAGATCCAGTTGGTACAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACAACCTATGGAATGAGCTGGGTGAAACAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCTAC......TCTGGAGTGCCAACATATGCTGATGACTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGC
IGHV-ZWCI 12022-05-15IGHV1-53*01|Mus_musculus_C57BL/6watson_et_al:MSM_MsJ_IGHV1-14FMSM/MsJCAGGTCCAACTGCAGCAGCCTGGGACTGAACTGGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTAATCCTAGCAATGGTGGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTCAGGTCCAACTGCAGCAGCCTGGGACT...GAACTGGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTAATCCTAGC......AATGGTGGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGT

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

History

History logs the times and reasons for the publication of each version of this germline set. Key changes are noted. For detailed changes, click on the link to the sequence.

William Lees
2022-05-15 15:41:28
Mouse germline set G00051 (MSM/MsJ IGH) created

Mouse germline set G00051 (MSM/MsJ IGH) created

William Lees
2022-05-15 15:55:54
Version 1 published

First release

Versions

All published versions of this germline set.

Set NameSpeciesSpecies subgroupLocusRelease VersionRelease Date
MSM/MsJ IGHMouseMSM/MsJIGH12022-05-15