Submission S00007 (Chaim A Schramm)
Submission Details
| Submission ID | S00007 |
| Submission Date | 2018-12-05 00:00:00 |
| Submission Status | complete |
| Submitter | Chaim A Schramm |
| Submitter Address | Vaccine Research Center, NIAID, NIH, Bethesda, MD USA |
| Species | Human |
| Ethnicity | UN |
Inferred Sequences
The inferred novel alleles from each genotype that are submitted for review. This table lists all inferences put forward by the submitter. Where IARC has affirmed a sequence based on an inference, the corresponding sequence record will be listed in the Published column. Inferences for which no published sequence is shown have not been affirmed.
| Sequence | Subject | Genotype | Published | |
|---|---|---|---|---|
| IGHV1-8*02+G209T | LP08248 | LP08248 | ||
| IGHV2-70*11+G1A | LP08248 | LP08248 |
Genotypes
Each genotype that has been inferred, along with the descriptive name of the inference tool and settings that were used.
| Genotype Name | Subject ID | Locus | Sequence Type | Genotype Filename | Tool/Setting Name | |
|---|---|---|---|---|---|---|
| LP08248 | LP08248 | IGH | V | 08248_genotype.csv | partis |
Acknowledgements
Individuals who should be acknowledged as contributing to the inferences listed in this submission.
Repertoire Details
Details of the repertoire from which the inferences are based. This corresponds, for example, to an NIH Project or an ENA study.
| Repository | NCBI SRA |
| Accession Number | PRJNA336331 |
| Project/Study Title | BCR repertoires from normal human donors |
| Dataset URL | https://www.ncbi.nlm.nih.gov/bioproject/PRJNA336331 |
| MiAIRR Compliant? | No |
| MiAIRR URL | |
| Sequencing Platform | 454 GS FLX |
| Read Length | 600 |
| Primers Overlapping? | No |
Repertoire Publications
Publications associated with this study.
| PubMed ID | Title | Authors |
|---|---|---|
| 28539926 | Gene-Specific Substitution Profiles Describe the Types and Frequencies of Amino Acid Changes during Antibody Somatic Hypermutation. | Sheng Z, Schramm CA, Kong R, NISC Comparative Sequencing Program., Mullikin JC, Mascola JR, Kwong PD, Shapiro L |
Sequences of the PCR primers used in the study.
5'RACE-IgM PCR
First strand cDNA used poly-dT and SMARTER template switch oligo
| Primer Name | Primer Sequence |
|---|---|
| IgM Outer | GAGGGGGAAAAGGGTTGGGGCGG |
| 454-IgM-R | CCTATCCCCTGTGTGCCTTGGCAGTCTCAGGAGGGGGAAAAGGGTTGGGGCGG |
| 454-RACE-F | CCATCTCATCCCTGCGTGTCTCCGACTCAGAAGCAGTGGTATCAACGCAGAGT |
Inference Tools and Settings
Details of the inference tools and settings used to infer novel alleles. Each combination of tool and setting is listed here, and provided with a descriptive name.
| Tool/Settings Name | Tool Name | Tool Version | |
|---|---|---|---|
| partis | partis | v0.14.0-00421b4 |
Notes
No notes provided