Submission Details

Submission IDS00007
Submission Date2018-12-05 00:00:00
Submission Statuscomplete
SubmitterChaim A Schramm
Submitter AddressVaccine Research Center, NIAID, NIH, Bethesda, MD USA
SpeciesHuman
EthnicityUN

Inferred Sequences

The inferred novel alleles from each genotype that are submitted for review. This table lists all inferences put forward by the submitter. Where IARC has affirmed a sequence based on an inference, the corresponding sequence record will be listed in the Published column. Inferences for which no published sequence is shown have not been affirmed.

SequenceSubjectGenotypePublished
 IGHV1-8*02+G209TLP08248LP08248
 IGHV2-70*11+G1ALP08248LP08248
 IGHV4-31*03+A66GLP08248LP08248A00012
 IGHV4-59*01+T260CLP08248LP08248A00010
 IGHV5-51*03+C203TLP08248LP08248A00013

Genotypes

Each genotype that has been inferred, along with the descriptive name of the inference tool and settings that were used.

Genotype NameSubject IDLocusSequence TypeGenotype FilenameTool/Setting Name
 LP08248LP08248IGHV08248_genotype.csvpartis

Acknowledgements

Individuals who should be acknowledged as contributing to the inferences listed in this submission.

No Items

Repertoire Details

Details of the repertoire from which the inferences are based. This corresponds, for example, to an NIH Project or an ENA study.

RepositoryNCBI SRA
Accession NumberPRJNA336331
Project/Study TitleBCR repertoires from normal human donors
Dataset URLhttps://www.ncbi.nlm.nih.gov/bioproject/PRJNA336331
MiAIRR Compliant?No
MiAIRR URL
Sequencing Platform454 GS FLX
Read Length600
Primers Overlapping?No

Repertoire Publications

Publications associated with this study.

PubMed IDTitleAuthors
28539926Gene-Specific Substitution Profiles Describe the Types and Frequencies of Amino Acid Changes during Antibody Somatic Hypermutation.Sheng Z, Schramm CA, Kong R, NISC Comparative Sequencing Program., Mullikin JC, Mascola JR, Kwong PD, Shapiro L

Sequences of the PCR primers used in the study.

5'RACE-IgM PCR

First strand cDNA used poly-dT and SMARTER template switch oligo

Primer NamePrimer Sequence
IgM OuterGAGGGGGAAAAGGGTTGGGGCGG
454-IgM-RCCTATCCCCTGTGTGCCTTGGCAGTCTCAGGAGGGGGAAAAGGGTTGGGGCGG
454-RACE-FCCATCTCATCCCTGCGTGTCTCCGACTCAGAAGCAGTGGTATCAACGCAGAGT

Inference Tools and Settings

Details of the inference tools and settings used to infer novel alleles. Each combination of tool and setting is listed here, and provided with a descriptive name.

Tool/Settings NameTool NameTool Version
 partispartisv0.14.0-00421b4

Notes

No notes provided