Sequence IGHV1-2*05
Details
| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGHV1-2*05 |
| IUIS Name | IGHV1-2*05 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged Observations
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| HM855681 | Nonlocational | GenBank | 1 | 348 | ||
| SRX19355457 | V | Genbank | 1 | 477 |
Observations in AIRR-seq Repertoires
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR delineation
| CDR1 Start | 218 |
| CDR1 End | 241 |
| CDR2 Start | 293 |
| CDR2 End | 316 |
| CDR3 Start | 431 |
Non-Core Regions
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCCACAG |
| L-PART2 Start | 132 |
| L-PART2 End | 142 |
| L_PART2 | GAGCCCACTCC |
| v_rs_start | 439 |
| v_rs_end | 477 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | TCAGAAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
Extension
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
Additional Information
| Sequence ID | A02959 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 3 |
| Release Date | 2026-05-27 |
| Release Notes | Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 1 |
| Gene Designation | 2 |
| Allele Designation | 05 |
| Gene start | 143 |
| Gene end | 438 |
Notes
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: Annotation of L-PART2 removed as this is in conflict with that observed by Huang, Thörnqvist and Ohlin, 2021 Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
Attachments
History
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-08-15 12:54:48 | Version 1 published Sequences added following discussion at IARC meeting on 9th August 2023 |
| William Lees 2024-02-23 15:40:50 | Version 2 published Remove the questionable annotation of L-PART1 |
| William Lees 2026-05-27 07:52:10 | Version 3 published Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
Changes from previous version
| v2 | v3 | |
|---|---|---|
| Curator address | Birkbeck College, University of London, Malet Street, London | Clareo Biosciences, Louisville, Kentucky, USA |
| Mapped | False | True |
| Inference Type | Unrearranged Only | Unrearranged |
| Subgroup type | none | |
| Full Sequence | ||
| Gene start | 30 | 143 |
| Gene end | 325 | 438 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 132 | |
| L-PART2 End | 142 | |
| CDR1 Start | 105 | 218 |
| CDR1 End | 128 | 241 |
| CDR2 Start | 180 | 293 |
| CDR2 End | 203 | 316 |
| CDR3 Start | 318 | 431 |
| v_rs_start | 326 | 439 |
| v_rs_end | 354 | 477 |
| 3' Extension | ||
| 5' Extension | ||
| curational_tags | likely_full-length | likely_full_length |
| Notes | changed |
Versions
All published versions of this sequence.
| Sequence Name | IMGT Name | Version | Date |
|---|---|---|---|
| IGHV1-2*05 | IGHV1-2*05 | 1 | 2023-08-15 |
| IGHV1-2*05 | IGHV1-2*05 | 2 | 2024-02-23 |
| IGHV1-2*05 | IGHV1-2*05 | 3 | 2026-05-27 |