Details

SpeciesHomo sapiens
Species subgroup
Subgroup type
Sequence NameIGHV1-2*06
IUIS NameIGHV1-2*06
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeUnrearranged and rearranged
MappedTrue
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEndCoding SequenceSC Coding Sequence
MH779621InferredGenBank1295
SRX19354849VGenbank1477

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start218
CDR1 End241
CDR2 Start293
CDR2 End316
CDR3 Start431

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCCACAG
L-PART2 Start132
L-PART2 End142
L_PART2GAGCCCACTCC
v_rs_start439
v_rs_end477
V_HEPTAMERCACAGTG
V_NONAMERTCAGAAACC
Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA00003
CuratorWilliam Lees
Curator addressClareo Biosciences, Louisville, Kentucky, USA
Version5
Release Date2026-05-27
Release Notes

Repeat – had to roll back yesterday’s changes.

Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names

LocusIGH
Sequence TypeV
Gene Subgroup1
Gene Designation2
Allele Designation06
Gene start143
Gene end438

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Originally approved by IARC on March 9, 2018.

“The sequence was inferred by Martin Corcoran using IgDiscover, and by Duncan Ralph using both Partis and TIgGER. The number of unique CDR3 used by sequences with exact matches to the inferred germline allele represents 1.9% [NOTE: 1.77% using the herein used approach to define number of exact matches] of all unique CDR3 associated to exact IGHV matches in the genotype,according to IgDiscover. There were at least 739 unique rearrangements, utilizing 19 D genes and 7 J genes, and hundreds of exact matches. The allele was the more frequently utilized allele, with an expression ratio of 70:30 with the *01 allele. The inference was supported by haplotype analysis using IGHJ6*02/*03. The sequence is present in the IgPdb as IGHV1-2*p06. The full length sequence was first reported to IgPdb in 2015 by Scheepers and colleagues (see J Immunol 194:4371-8) from genomic sequencing, and it was separately reported to IgPdb in 2016 by Kirik and colleagues (see Mol Immunol 87:12-22), as an inference from VDJ rearrangements.”

In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 319.

(April 12, 2019) A trailing “.” in the sequence indicates IARC’s opinion that the sequence is likely to contain additional 3’ nucleotides for which there is insufficient evidence to make an affirmation.

The allele was incorporated into IMGT on July 24, 2018 as IGHV1-2*06.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample MH779621
VDJbase example haplotype: P1_I27_S1
Mapped by P1_I27 haplotype

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Annotation is based on VDJbase record P25_I59_S1 for sample SC-24 (Genbank: SRX19354849).

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2018-12-21 11:57:50
Version 1 published

Submission published by IARC on Dec 21, 2018.

Andrew Collins
2019-04-03 04:11:05
Version 2 published

This version was created to include details highlighting the fact that the published sequence was affirmed up to and including nucleotide 319, but the submitted sequence was one nucleotide longer.

Mats Ohlin
2019-04-12 14:53:18
Version 3 published

A trailing “.” in the sequence indicates IARC’s opinion that the sequence is likely to contain additional 3’ nucleotides for which there is insufficient evidence to make an affirmation.

William Lees
2023-07-10 11:24:35
Version 4 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2026-05-27 07:52:09
Version 5 published

Repeat – had to roll back yesterday’s changes.

Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names

Changes from previous version

v4v5
Curator addressBirkbeck College, University of London, Malet Street, LondonClareo Biosciences, Louisville, Kentucky, USA
Alternative namesIGHV1-2*i01
Inference TypeRearranged OnlyUnrearranged and rearranged
Full Sequence
Coding Sequence
Gene start1143
Gene end295438
L-PART1 Start1
L-PART1 End46
L-PART2 Start132
L-PART2 End142
CDR1 Start76218
CDR1 End99241
CDR2 Start151293
CDR2 End174316
CDR3 Start289431
v_rs_start439
v_rs_end477
Extension?TrueFalse
3' ExtensionA
curational_tagslikely_truncatedlikely_full_length
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIUIS NameVersionDate
IGHV1-2*i01IGHV1-2*0612018-12-21
IGHV1-2*i01IGHV1-2*0622019-04-03
IGHV1-2*i01IGHV1-2*0632019-04-12
IGHV1-2*06IGHV1-2*0642023-07-10
IGHV1-2*06IGHV1-2*0652026-05-27