Details

SpeciesHomo sapiens
Species subgroup
Subgroup typenone
Sequence NameIGHV3-33*i01
IUIS NameIGHV3-33*08
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityF
Inference TypeRearranged Only
Mapped
Paralogs
Paralog Rep

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start76
CDR1 End99
CDR2 Start151
CDR2 End174
CDR3 Start289

Non-Core Regions

Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Additional Information

Sequence IDA00068
CuratorMats Ohlin
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version1
Release Date2021-11-01
Release Notes

Submission published by IARC on November 1st, 2021

LocusIGH
Sequence TypeV
Gene Subgroup3
Gene Designation33
Allele Designationi01
Gene start1
Gene end295

Acknowledgements

Individuals acknowledged as contributing to this sequence:

NameInstitutionORCID ID
William LeesBirkbeck College, University of London, Malet Street, London
Ayelet PeresBar-Ilan University, Ramat-Gan, Israel
Gur YaariBar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.

IARC meeting 62 (Nov 3rd, 2020):
The meeting considered the inference of the variant IGHV3-33*01_g75c in the VDJbase datasets of samples P1_I46_S1 and P1_I93_S1. Similar frequencies were seen in the two samples, and data recorded here comes from the P1_I46 sample. The sequence was seen in 1.94% of all unmutated rearrangements, with 386 sequences including 314 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-33*01 was also present in the genotype, at a similar frequency (2.40% of all unmutated sequences, 466 sequences, 388 unmutated sequences). Plots of the final 3’ nucleotides were unavailable. Haplotyping data strongly supported the inference. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes.

iARC meeting 82 (Oct 11th, 2021):
IGHV3-33*01_G75C was inferred in a genotype (VDJbase P1_I46). This inference has previously been pre-assessed at IARC meeting 62 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2021/04/Meeting-62-3_11_20-minutes.pdf). Among alleles of the IGHV3-30/IGHV3-30-3/IGHV3-33 set the genotype in addition only carried IGHV3-33*01 as defined by OGRDB. The two alleles were supported by similar numbers of sequences (allelic frequency 46%). IGHV3-33*01_G75C was associated to multiple (388) unique CDR3s. The genotype of this subject as defined by VDJbase also features IGHV3-30*18/IGHV3-30-5*01. IgDiscover-based analysis has also identified IGHV3-30*18 in this genotype. This lack of definition of this allele in the haplotyped data in VDJbase is being addressed. Haplotyping based on alleles of IGHJ6 supported its presence (ratio: 99:1 (IGHV3-33*01) and 2:98 (IGHV3-33*01_G75C), respectively). IGHV3-33*01_G75C is identical to IGHV3-33*08 that entered into the IMGT-DB on March 5th, 2021 based on its presence in GenBank entry accession number AC279998. IARC affirms, based on information in the transcriptome of this subject, the sequence as a level 1 sequence up to and including base 319 in agreement with past practice. A trailing “.” indicates IARC’s opinion that the sequence is likely to contain an additional 3’ nucleotide for which there is insufficient evidence to make an affirmation. It is acknowledged that the allele most likely carry one additional base, typically A at base position 320. The allele is given the name IGHV3-33*i01. We recognise that this allele might have been located at IGHV3-30, IGHV3-30-3, IGHV3-30-5, and/or IGHV3-33 in this subject and IARC gene naming does not reflect a position on this matter.

>IGHV3-33*i01
CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAG.

Attachments

Supplementary Files
 Human_IGH_P1_I46_S1_genotype.pdf
 

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2021-11-01 22:49:12
Version 1 published

Submission published by IARC on November 1st, 2021

Versions

All published versions of this sequence.

Sequence NameIMGT NameVersionDate
IGHV3-33*i01IGHV3-33*0812021-11-01
IGHV3-33*08IGHV3-33*0822023-07-10
IGHV3-33*08IGHV3-33*0832026-05-27