| IARC meeting 62 (Nov 3rd, 2020):
The meeting considered the inference of the variant IGHV3-33*01_g75c in the VDJbase datasets of samples P1_I46_S1 and P1_I93_S1. Similar frequencies were seen in the two samples, and data recorded here comes from the P1_I46 sample. The sequence was seen in 1.94% of all unmutated rearrangements, with 386 sequences including 314 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-33*01 was also present in the genotype, at a similar frequency (2.40% of all unmutated sequences, 466 sequences, 388 unmutated sequences). Plots of the final 3’ nucleotides were unavailable. Haplotyping data strongly supported the inference. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes.
iARC meeting 82 (Oct 11th, 2021):
IGHV3-33*01_G75C was inferred in a genotype (VDJbase P1_I46). This inference has previously been pre-assessed at IARC meeting 62 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2021/04/Meeting-62-3_11_20-minutes.pdf). Among alleles of the IGHV3-30/IGHV3-30-3/IGHV3-33 set the genotype in addition only carried IGHV3-33*01 as defined by OGRDB. The two alleles were supported by similar numbers of sequences (allelic frequency 46%). IGHV3-33*01_G75C was associated to multiple (388) unique CDR3s. The genotype of this subject as defined by VDJbase also features IGHV3-30*18/IGHV3-30-5*01. IgDiscover-based analysis has also identified IGHV3-30*18 in this genotype. This lack of definition of this allele in the haplotyped data in VDJbase is being addressed. Haplotyping based on alleles of IGHJ6 supported its presence (ratio: 99:1 (IGHV3-33*01) and 2:98 (IGHV3-33*01_G75C), respectively). IGHV3-33*01_G75C is identical to IGHV3-33*08 that entered into the IMGT-DB on March 5th, 2021 based on its presence in GenBank entry accession number AC279998. IARC affirms, based on information in the transcriptome of this subject, the sequence as a level 1 sequence up to and including base 319 in agreement with past practice. A trailing “.” indicates IARC’s opinion that the sequence is likely to contain an additional 3’ nucleotide for which there is insufficient evidence to make an affirmation. It is acknowledged that the allele most likely carry one additional base, typically A at base position 320. The allele is given the name IGHV3-33*i01. We recognise that this allele might have been located at IGHV3-30, IGHV3-30-3, IGHV3-30-5, and/or IGHV3-33 in this subject and IARC gene naming does not reflect a position on this matter.
>IGHV3-33*i01
CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAG. |