The inference of IGHV4-61*01_A41G was considered at IARC meeting 116 on Feb 27th, 2023.

IGHV4-61*01_A41G has been inferred in one genotype (P1_I23) in VDJbase P1 data set. The genotype also carries IGHV4-61*01. IGHV4-61*01_A41G represents 0.32% of the total unmutated population. It is represented by 91 unmutated error-free sequences and 91 unique CDR3s of different lengths in the error-free set. Haplotyping based on allelic diversity in IGHJ6 demonstrates association of the haplotype defined by IGHJ6*02 (100:0 ratio) (IGHV4-61*01 shows a haplotype ratio of 7:93).

Other genes carry alleles defined by IMGT, alleles that are highly similar to IGHV4-61*01 A41G. These genes include IGHV4-59 and IGHV4-4 (>97% sequence identity). In no case do these alleles carry the A41G SNP.

IARC affirms the sequence as IGHV4-61*i04 at Level 1 up to and including base 319. It is acknowledged that the allele most likely carries 1 additional base, typically A, at base positions 320. Trailing “.” indicates IARC’s opinion that the sequence is likely to contain additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence.

>IGHV4-61*i04
CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAGGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAG.

The locus on chromosome 14 that carries human IGHV genes is highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. Other similar genes have been mentioned above.