Details

SpeciesHuman
Species subgroup
Subgroup typenone
Sequence NameIGHV4-61*i04
IUIS Name
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityF
Inference TypeRearranged
Mapped
Paralogs
Paralog Rep

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele NameSubjectsSequence Match
IGHV4-61*01_a41g 1

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

CDR delineation

CDR1 Start76
CDR1 End105
CDR2 Start157
CDR2 End177
CDR3 Start292

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start
L-PART1 End
L_PART1
L-PART2 Start
L-PART2 End
L_PART2
v_rs_start
v_rs_end
V_HEPTAMER
V_NONAMER

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02567
CuratorMats Ohlin
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version1
Release Date2023-03-20
Release Notes

Published by IARC on March 20th, 2023.

LocusIGH
Sequence TypeV
Gene Subgroup4
Gene Designation61
Allele Designationi04

Acknowledgements

Individuals acknowledged as contributing to this sequence:

NameInstitutionORCID ID
William LeesBirkbeck College, University of London, Malet Street, London
Ayelet PeresBar-Ilan University, Ramat-Gan, Israel
Gur YaariBar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.

The inference of IGHV4-61*01_A41G was considered at IARC meeting 116 on Feb 27th, 2023.

IGHV4-61*01_A41G has been inferred in one genotype (P1_I23) in VDJbase P1 data set. The genotype also carries IGHV4-61*01. IGHV4-61*01_A41G represents 0.32% of the total unmutated population. It is represented by 91 unmutated error-free sequences and 91 unique CDR3s of different lengths in the error-free set. Haplotyping based on allelic diversity in IGHJ6 demonstrates association of the haplotype defined by IGHJ6*02 (100:0 ratio) (IGHV4-61*01 shows a haplotype ratio of 7:93).

Other genes carry alleles defined by IMGT, alleles that are highly similar to IGHV4-61*01 A41G. These genes include IGHV4-59 and IGHV4-4 (>97% sequence identity). In no case do these alleles carry the A41G SNP.

IARC affirms the sequence as IGHV4-61*i04 at Level 1 up to and including base 319. It is acknowledged that the allele most likely carries 1 additional base, typically A, at base positions 320. Trailing “.” indicates IARC’s opinion that the sequence is likely to contain additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence.

>IGHV4-61*i04
CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAGGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAG.

The locus on chromosome 14 that carries human IGHV genes is highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. Other similar genes have been mentioned above.

Attachments

Supplementary Files
 IGHV4-61*i04_meeting 116.pdf

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2023-03-20 08:45:34
Version 1 published

Published by IARC on March 20th, 2023.

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeGene startGene endUTR 5' StartUTR 5' EndL-PART1 StartL-PART1 EndL-PART2 StartL-PART2 EndCDR1 StartCDR1 EndCDR2 StartCDR2 EndCDR3 Startv_rs_startv_rs_endd_rs_3_prime_startd_rs_3_prime_endd_rs_5_prime_startd_rs_5_prime_endj_rs_startj_rs_endCodon FrameVersionDate
IGHV4-61*i04Rearranged1none129876105157177292112023-03-20
IGHV4-61*i04Rearranged Only112987610515717729222023-07-10