Details


Species	Human
Species subgroup
Subgroup type	none
Sequence Name	IGHV4-61*i04
IUIS Name
Alternative names
Affirmation Level	1
Full Sequence
Coding Sequence
Functionality	F
Inference Type	Rearranged
Alternative names
Paralogs

Evidence

The table below lists the submissions, and the inferences within them, on which this published sequence is based. The list may be short when the sequence is first published, containing, for example, reference to just a single submission, but is expected to grow over time as additional inferences are submitted.

'Sequence Match' indicates whether the inference exactly matches the sequence, and clicking on the tick or cross will provide an alignment. Mismatches may be caused, for example, by the inclusion of leader sequences, or nucleotides in the inference which do not in IARC's opinion have sufficient evidence for inclusion in the sequence.

Submission ID	Accession No	Subject ID	Genotype Name	Sequence Name	Sequence Match
S00038	OX384050	S23	P1_I23_S1	IGHV4-61*01_A41G

Supporting Observations

Sequences in other published genotypes which have been identified by IARC and support the inference:

No Items

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele Name	Subjects	Sequence Match
IGHV4-61*01_a41g	1

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

Non-Core Regions


UTR 5' Start
UTR 5' End
L-PART1 Start
L-PART1 End
L-PART2 Start
L-PART2 End
v_rs_start
v_rs_end

Extension


3' Extension
3' start
3' end
5' start
5' end

Additional Information


Sequence ID	A02567
Curator address	Dept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version	1
Release Date	2023-03-20
Release Notes	Published by IARC on March 20th, 2023.
Locus	IGH
Sequence Type	V
Gene Subgroup	4
Gene Designation	61
Allele Designation	i04

Acknowledgements

Individuals acknowledged as contributing to this sequence:

Name	Institution	ORCID ID
William Lees	Birkbeck College, University of London, Malet Street, London
Ayelet Peres	Bar-Ilan University, Ramat-Gan, Israel
Gur Yaari	Bar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.


The inference of IGHV4-6101_A41G was considered at IARC meeting 116 on Feb 27th, 2023. IGHV4-6101_A41G has been inferred in one genotype (P1_I23) in VDJbase P1 data set. The genotype also carries IGHV4-6101. IGHV4-6101_A41G represents 0.32% of the total unmutated population. It is represented by 91 unmutated error-free sequences and 91 unique CDR3s of different lengths in the error-free set. Haplotyping based on allelic diversity in IGHJ6 demonstrates association of the haplotype defined by IGHJ602 (100:0 ratio) (IGHV4-6101 shows a haplotype ratio of 7:93). Other genes carry alleles defined by IMGT, alleles that are highly similar to IGHV4-6101 A41G. These genes include IGHV4-59 and IGHV4-4 (>97% sequence identity). In no case do these alleles carry the A41G SNP. IARC affirms the sequence as IGHV4-61i04 at Level 1 up to and including base 319. It is acknowledged that the allele most likely carries 1 additional base, typically A, at base positions 320. Trailing “.” indicates IARC’s opinion that the sequence is likely to contain additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence. >IGHV4-61*i04 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAGGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAG. The locus on chromosome 14 that carries human IGHV genes is highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. Other similar genes have been mentioned above.

The inference of IGHV4-61*01_A41G was considered at IARC meeting 116 on Feb 27th, 2023.

IGHV4-61*01_A41G has been inferred in one genotype (P1_I23) in VDJbase P1 data set. The genotype also carries IGHV4-61*01. IGHV4-61*01_A41G represents 0.32% of the total unmutated population. It is represented by 91 unmutated error-free sequences and 91 unique CDR3s of different lengths in the error-free set. Haplotyping based on allelic diversity in IGHJ6 demonstrates association of the haplotype defined by IGHJ6*02 (100:0 ratio) (IGHV4-61*01 shows a haplotype ratio of 7:93).

Other genes carry alleles defined by IMGT, alleles that are highly similar to IGHV4-61*01 A41G. These genes include IGHV4-59 and IGHV4-4 (>97% sequence identity). In no case do these alleles carry the A41G SNP.

IARC affirms the sequence as IGHV4-61*i04 at Level 1 up to and including base 319. It is acknowledged that the allele most likely carries 1 additional base, typically A, at base positions 320. Trailing “.” indicates IARC’s opinion that the sequence is likely to contain additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence.

>IGHV4-61*i04
CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAGGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAG.

The locus on chromosome 14 that carries human IGHV genes is highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. Other similar genes have been mentioned above.

Attachments

	Supplementary Files
	IGHV4-61*i04_meeting 116.pdf

History

History logs the times and reasons for the publication of each version of this sequence.


Mats Ohlin 2023-03-20 08:45:34	Version 1 published Published by IARC on March 20th, 2023.

Versions

All published versions of this sequence.

Sequence Name	IMGT Name	Alternative names	Inference Type	Affirmation Level	Species subgroup	Subgroup type	Version	Date
IGHV4-61*i04			Rearranged	1		none	1	2023-03-20