Details

SpeciesHomo sapiens
Species subgroup
Subgroup typenone
Sequence NameIGHV3-30*i02
IUIS Name
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityF
Inference TypeRearranged Only
Mapped
Paralogs
Paralog Rep

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start76
CDR1 End99
CDR2 Start151
CDR2 End174
CDR3 Start289

Non-Core Regions

Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Additional Information

Sequence IDA02569
CuratorMats Ohlin
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version1
Release Date2023-03-20
Release Notes

Published by IARC on March 20th, 2023.

LocusIGH
Sequence TypeV
Gene Subgroup3
Gene Designation
Allele Designation
Gene start1
Gene end295

Acknowledgements

Individuals acknowledged as contributing to this sequence:

NameInstitutionORCID ID
William LeesBirkbeck College, University of London, Malet Street, London
Ayelet PeresBar-Ilan University, Ramat-Gan, Israel
Gur YaariBar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.

The inference IGHV3-30*i02 was considered at IARC meeting 116 on February 27th, 2023

IGHV3-30*04 C201T has been inferred in one genotype (P1_I70) in VDJbase P1 data set. The genotype also carries related alleles like IGHV3-30-3*01 and IGHV3-30*18. It is represented by 394 error-free sequences and 374 unique CDR3s of different lengths in the error-free set. Haplotyping based on allelic diversity in IGHJ6 demonstrates association of the haplotype defined by IGHJ6*03 (99:1 ratio). IGHV3-30-3*01 and IGHV3-30*18 are more abundant but also present on both haplotypes. On the haplotype in question IGHV3-30-3*01, IGHV3-30*18, and inferred IGHV3-30*04 C201T are present at approximately a 2:2:1 ratio.

Inspection of the sequences associated with the inference demonstrates that base 317 is A, not G as implied by the outcome of the inference, demonstrating that IGHV3-30*04 C201T G317A (a sequence identical to IGHV3-30*18 G113C C114T) is the allele in question. A past study has, using IgDiscover v.0.12, inferred IGHV3-30*04 C201T G317A/IGHV3-30*18 G113C C114T in this data set (Huang et al. Front Immunol 12:730105; DOI: 10.3389/fimmu.2021.730105). Upstream regions of these alleles were also inferred in that study. The upstream region of IGHV3-30*04 C201T G317A was identical to that of IGHV3-30*18 but differed in four positions from that of IGHV3-30-3*01.

IARC affirmed the sequence at Level 0 at Meeting 115, to possibly be upgraded to level 1 pending further discussion. IARC now affirms the sequence at level 1 up to and including base 319. It is acknowledged that the allele most likely carries 1 additional base, typically A, at base positions 320. The trailing “.” indicates IARC’s opinion that the sequence is likely to contain one additional 3’-nucleotide for which there is insufficient evidence to make an affirmation. The GenBank record (OX384049) is publicly available and reports the sequence of IGHV3-30*04 C201T G317A, up to and including base 320. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence.

>IGHV3-30*i02
CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAG.

The locus on chromosome 14 that carries human IGHV genes is highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The IGHV3-30, IGHV3-30-3, IGHV3-30-5, and IGHV3-33 harbors very similar alleles, some of which are identical. For instance IGHV3-30*18 is found at both IGHV3-30 and IGHV3-30-5 (in that case: IGHV3-30-5*01) and IGHV3-30*04 is also found at IGHV3-30-3 (as IGHV3-30-3*03). Inference does not provide proof of the gene of the inferred allele. The gene of the inferred allele IGHV3-30*04 C201T G317A cannot be defined. Any name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just, according to past practice of IARC, relates to the most similar allele that has previously been recognised, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. Other similar genes have been mentioned above.

Attachments

Attachment File Name
 IGHV3-30*i02_meeting 116.pdf

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2023-03-20 08:44:27
Version 1 published

Published by IARC on March 20th, 2023.

Versions

All published versions of this sequence.

Sequence NameIMGT NameVersionDate
IGHV3-30*i0212023-03-20
IGHV3-30*i0222023-07-10