
The germline set is based on sequences published in Jackson et al. (2022) (in preparation)


AuthorKatherine JL Jackson
Lab Name
Lab AddressGarvan Institute of Medical Research, Darlinghurst, NSW, Australia
NameC57BL/6 IGH
Species subgroupC57BL/6
Subgroup typestrain
Release Version3
Release DescriptionFirst release – as published in Jackson et al. (2022) (in preparation)
Release Date2022-06-02

Included Sequences

LabelVnDateIMGT NameAlt NamesFunctionalitySubgrpSequenceGapped Sequence
IGHD-4WOL 12022-06-02IGHD3-2*02|Mus_musculus_C57BL/6Jcollins_et_al_2015:IGHD3-2*02FC57BL/6AGACAGCTCAGGCTACAGACAGCTCAGGCTAC
IGHD-5S4H 12022-06-02IGHD4-1*01|Mus_musculus_BALB/ccollins_et_al_2015:IGHD4-1*01FC57BL/6CTAACTGGGACCTAACTGGGAC
IGHD-6HI7 12022-06-02IGHD2-4*01|Mus_musculus_BALB/c,IGHD2-9*02|Mus_musculus_129/Svcollins_et_al_2015:IGHD2-4*01FC57BL/6TCTACTATGATTACGACTCTACTATGATTACGAC
IGHD-BTUW 12022-06-02IGHD2-2*01|Mus_musculus_BALB/c,IGHD2-7*01|Mus_musculus_BALB/ccollins_et_al_2015:IGHD2-7*01FC57BL/6TCTACTATGGTTACGACTCTACTATGGTTACGAC
IGHD-W5WR 12022-06-02IGHD2-1*01|Mus_musculus_129/Sv,IGHD2-8*01|Mus_musculus_BALB/ccollins_et_al_2015:IGHD2-8*01FC57BL/6TCTACTATGGTAACTACTCTACTATGGTAACTAC
IGHD-XZUH 12022-06-02IGHD2-3*01|Mus_musculus_BALB/ccollins_et_al_2015:IGHD2-3*01FC57BL/6TCTATGATGGTTACTACTCTATGATGGTTACTAC
IGHD-Y63W 12022-06-02IGHD2-5*01|Mus_musculus_CB.20,IGHD2-6*01|Mus_musculus_C57BL/6Jcollins_et_al_2015:IGHD2-5*01,collins_et_al_2015:IGHD2-6*01FC57BL/6CCTACTATAGTAACTACCCTACTATAGTAACTAC


Individuals acknowledged as contributing to this sequence:

No Items


History logs the times and reasons for the publication of each version of this germline set. Key changes are noted. For detailed changes, click on the link to the sequence.

William Lees
2022-03-08 17:29:49
Mouse germline set G00004 (C57BL/6 IGH) created

Mouse germline set G00004 (C57BL/6 IGH) created

William Lees
2022-03-08 17:37:41
Version 1 published

The germline set is based on sequences published in Jackson et al. (2022) (in preparation)

William Lees
2022-03-08 17:38:48
Version 2 published

Added brief note for download page

William Lees
2022-06-02 15:58:31
Version 3 published

Added D aand J sequences from Collins et al. (2015)


All published versions of this germline set.

Set NameSpeciesSpecies subgroupLocusRelease VersionRelease Date
C57BL/6 IGHMouseC57BL/6IGH12022-03-08
C57BL/6 IGHMouseC57BL/6IGH32022-06-02