Notes

IGKJ genes for use with all strains

As published in Kos et al. (2022) (in preparation)

Details

AuthorWilliam Lees
Lab Name
Lab AddressBirkbeck College, University of London, Malet Street, London
NameIGKJ (all strains)
SpeciesMouse
Species subgroup
Subgroup typenone
LocusIGK
Release Version1
Release DescriptionFirst release
Release Date2022-05-31
doi10.5281/zenodo.7116926

Included Sequences

LabelVnDateIMGT NameAlt NamesFunctionalitySubgrpSequenceGapped Sequence
IGKJ-4JXG 12022-05-31IGKJ1*01Kos et al: IGKJ1*01FGTGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAACGTGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAAC
IGKJ-5NUZ 12022-05-31IGKJ3*02Kos et al: IGKJ3*02ORFAACCACATTCAGTGATGGGACCAGACTGGAAATAAAACAACCACATTCAGTGATGGGACCAGACTGGAAATAAAAC
IGKJ-ABRI 12022-05-31Kos et al: IGKJ2*03_15FTGTACACGTTCGGATCGGGGACCAAGCTGGAAATAAAACTGTACACGTTCGGATCGGGGACCAAGCTGGAAATAAAAC
IGKJ-AR7L 12022-05-31IGKJ2*02Kos et al: IGKJ2*02FTGTATACGTTCGGATCGGGGACCAAGCTGGAAATGAAACTGTATACGTTCGGATCGGGGACCAAGCTGGAAATGAAAC
IGKJ-HVOR 12022-05-31IGKJ2*03Kos et al: IGKJ2*03FTGTATACGTTCGGATCGGGGACCAAGCTGGAAATAAAACTGTATACGTTCGGATCGGGGACCAAGCTGGAAATAAAAC
IGKJ-IIHF 12022-05-31IGKJ3*01Kos et al: IGKJ3*01ORFAATCACATTCAGTGATGGGACCAGACTGGAAATAAAACAATCACATTCAGTGATGGGACCAGACTGGAAATAAAAC
IGKJ-LUDL 12022-05-31IGKJ4*02Kos et al: IGKJ4*02FATTCACGTTCGGCACGGGGACAAAATTGGAAATAAAACATTCACGTTCGGCACGGGGACAAAATTGGAAATAAAAC
IGKJ-MXRV 12022-05-31IGKJ2*01Kos et al: IGKJ2*01FTGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAACTGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAAC
IGKJ-O4CL 12022-05-31IGKJ5*01Kos et al: IGKJ5*01FGCTCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAACGCTCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAAC
IGKJ-WRAP 12022-05-31IGKJ1*02Kos et al: IGKJ1*02FCCGACGTTCGGTGGAGGCACCAAGCTGGAAATCAATCCCGACGTTCGGTGGAGGCACCAAGCTGGAAATCAATC
IGKJ-Z5J4 12022-05-31IGKJ4*01Kos et al: IGKJ4*01FATTCACGTTCGGCTCGGGGACAAAGTTGGAAATAAAACATTCACGTTCGGCTCGGGGACAAAGTTGGAAATAAAAC

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

History

History logs the times and reasons for the publication of each version of this germline set. Key changes are noted. For detailed changes, click on the link to the sequence.

William Lees
2022-05-31 09:06:47
Mouse germline set G00054 (IGKJ (all strains)) created

Mouse germline set G00054 (IGKJ (all strains)) created

William Lees
2022-05-31 09:18:54
Version 1 published

First release

Versions

All published versions of this germline set.

Set NameSpeciesSpecies subgroupLocusRelease VersionRelease Datedoi
IGKJ (all strains)MouseIGK12022-05-3110.5281/zenodo.7116926