Submission ID | S00008 |
Submission Date | 2018-12-21 00:00:00 |
Submission Status | complete |
Submitter | Chaim A Schramm |
Submitter Address | Vaccine Research Center, NIAID, NIH, Bethesda, MD USA |
Species | Human |
Ethnicity | UN |
The inferred novel alleles from each genotype that are submitted for review. This table lists all inferences put forward by the submitter. Where IARC has affirmed a sequence based on an inference, the corresponding sequence record will be listed in the Published column. Inferences for which no published sequence is shown have not been affirmed.
Sequence | Subject | Genotype | Published | |
---|---|---|---|---|
IGHV1-58*01+G29A | LP23810 | LP23810 | A00014 | |
IGHV3-43*01+A96G.C197T.A261G | LP23810 | LP23810 | ||
IGHV3-64*05+A188C.G240C | LP23810 | LP23810 |
Each genotype that has been inferred, along with the descriptive name of the inference tool and settings that were used.
Genotype Name | Subject ID | Locus | Sequence Type | Genotype Filename | Tool/Setting Name | |
---|---|---|---|---|---|---|
LP23810 | LP23810 | IGH | V | 23810_genotype.csv | partis |
Individuals who should be acknowledged as contributing to the inferences listed in this submission.
Details of the repertoire from which the inferences are based. This corresponds, for example, to an NIH Project or an ENA study.
Repository | NCBI SRA |
Accession Number | PRJNA336331 |
Project/Study Title | BCR repertoires from normal human donors |
Dataset URL | https://www.ncbi.nlm.nih.gov/bioproject/PRJNA336331 |
MiAIRR Compliant? | No |
MiAIRR URL | |
Sequencing Platform | 454 GS FLX |
Read Length | 600 |
Primers Overlapping? | No |
Publications associated with this study.
PubMed ID | Title | Authors |
---|---|---|
28539926 | Gene-Specific Substitution Profiles Describe the Types and Frequencies of Amino Acid Changes during Antibody Somatic Hypermutation. | Sheng Z, Schramm CA, Kong R, NISC Comparative Sequencing Program., Mullikin JC, Mascola JR, Kwong PD, Shapiro L |
Sequences of the PCR primers used in the study.
First strand cDNA used poly-dT and SMARTER template switch oligo
Primer Name | Primer Sequence |
---|---|
IgM Outer | GAGGGGGAAAAGGGTTGGGGCGG |
454-IgM-R | CCTATCCCCTGTGTGCCTTGGCAGTCTCAGGAGGGGGAAAAGGGTTGGGGCGG |
454-RACE-F | CCATCTCATCCCTGCGTGTCTCCGACTCAGAAGCAGTGGTATCAACGCAGAGT |
Details of the inference tools and settings used to infer novel alleles. Each combination of tool and setting is listed here, and provided with a descriptive name.
Tool/Settings Name | Tool Name | Tool Version | |
---|---|---|---|
partis | partis | v0.14.0-00421b4 |
No notes provided