OGRDB

Submission Details


Submission ID	S00008
Submission Date	2018-12-21 00:00:00
Submission Status	complete
Submitter	Chaim A Schramm
Submitter Address	Vaccine Research Center, NIAID, NIH, Bethesda, MD USA
Species	Homo sapiens
Ethnicity	UN

Inferred Sequences

The inferred novel alleles from each genotype that are submitted for review. This table lists all inferences put forward by the submitter. Where IARC has affirmed a sequence based on an inference, the corresponding sequence record will be listed in the Published column. Inferences for which no published sequence is shown have not been affirmed.

	Sequence	Subject	Genotype	Published
	IGHV3-43*01+A96G.C197T.A261G	LP23810	LP23810
	IGHV3-64*05+A188C.G240C	LP23810	LP23810

Genotypes

Each genotype that has been inferred, along with the descriptive name of the inference tool and settings that were used.

	Genotype Name	Subject ID	Locus	Sequence Type	Genotype Filename	Tool/Setting Name
	LP23810	LP23810	IGH	V	23810_genotype.csv	partis

Acknowledgements

Individuals who should be acknowledged as contributing to the inferences listed in this submission.

No Items

Repertoire Details

Details of the repertoire from which the inferences are based. This corresponds, for example, to an NIH Project or an ENA study.


Repository	NCBI SRA
Accession Number	PRJNA336331
Project/Study Title	BCR repertoires from normal human donors
Dataset URL	https://www.ncbi.nlm.nih.gov/bioproject/PRJNA336331
MiAIRR Compliant?	No
MiAIRR URL
Sequencing Platform	454 GS FLX
Read Length	600
Primers Overlapping?	No

Repertoire Publications

Publications associated with this study.

PubMed ID	Title	Authors
28539926	Gene-Specific Substitution Profiles Describe the Types and Frequencies of Amino Acid Changes during Antibody Somatic Hypermutation.	Sheng Z, Schramm CA, Kong R, NISC Comparative Sequencing Program., Mullikin JC, Mascola JR, Kwong PD, Shapiro L

PCR Primers

Sequences of the PCR primers used in the study.

5'RACE-IgM PCR

First strand cDNA used poly-dT and SMARTER template switch oligo

Primer Name	Primer Sequence
IgM Outer	GAGGGGGAAAAGGGTTGGGGCGG
454-IgM-R	CCTATCCCCTGTGTGCCTTGGCAGTCTCAGGAGGGGGAAAAGGGTTGGGGCGG
454-RACE-F	CCATCTCATCCCTGCGTGTCTCCGACTCAGAAGCAGTGGTATCAACGCAGAGT

Inference Tools and Settings

Details of the inference tools and settings used to infer novel alleles. Each combination of tool and setting is listed here, and provided with a descriptive name.

	Tool/Settings Name	Tool Name	Tool Version
	partis	partis	v0.14.0-00421b4

Notes

No notes provided