| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGKV2-30*02 |
| IUIS Name | IGKV2-30*02 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| FM164408 | Nonlocational | GenBank | 1 | 302 | ||
| SRR26518947 | V | Genbank | 1 | 816 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 565 |
| CDR1 End | 597 |
| CDR2 Start | 649 |
| CDR2 End | 657 |
| CDR3 Start | 766 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 49 |
| L_PART1 | ATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCCCAG |
| L-PART2 Start | 476 |
| L-PART2 End | 486 |
| L_PART2 | GATCCAGTGGG |
| v_rs_start | 789 |
| v_rs_end | 816 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACAAAAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A02834 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 2 |
| Release Date | 2026-05-27 |
| Release Notes | Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P27 (PMID38844673), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| Locus | IGK |
| Sequence Type | V |
| Gene Subgroup | 2 |
| Gene Designation | 30 |
| Allele Designation | 02 |
| Gene start | 487 |
| Gene end | 788 |
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-07-10 11:24:44 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2026-05-27 08:07:26 | Version 2 published Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P27 (PMID38844673), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| v1 | v2 | |
|---|---|---|
| Curator address | Birkbeck College, University of London, Malet Street, London | Clareo Biosciences, Louisville, Kentucky, USA |
| Chromosome | 2 | 14 |
| Inference Type | Unrearranged and Rearranged | Unrearranged |
| Full Sequence | ||
| Gene start | 1 | 487 |
| Gene end | 302 | 788 |
| L-PART1 Start | 1 | |
| L-PART1 End | 49 | |
| L-PART2 Start | 476 | |
| L-PART2 End | 486 | |
| CDR1 Start | 79 | 565 |
| CDR1 End | 111 | 597 |
| CDR2 Start | 163 | 649 |
| CDR2 End | 171 | 657 |
| CDR3 Start | 280 | 766 |
| v_rs_start | 789 | |
| v_rs_end | 816 | |
| curational_tags | likely_full-length | likely_full_length |
| Notes | changed |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGKV2-30*02 | IGKV2-30*02 | 1 | 2023-07-10 |
| IGKV2-30*02 | IGKV2-30*02 | 2 | 2026-05-27 |