| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGHV3-20*05 |
| IUIS Name | IGHV3-20*05 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Inferred sequences in VDJbase that match this sequence:
| VDJbase Allele Name | Subjects | Sequence Match |
|---|---|---|
| IGHV3-20*04_a104g | 7 |
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| SRX19354883 | V | Genbank | 1 | 495 |
| CDR1 Start | 236 |
| CDR1 End | 259 |
| CDR2 Start | 311 |
| CDR2 End | 334 |
| CDR3 Start | 449 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAG |
| L-PART2 Start | 150 |
| L-PART2 End | 160 |
| L_PART2 | GTGTCCAGTGT |
| v_rs_start | 457 |
| v_rs_end | 495 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACACAAACG |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A08716 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 1 |
| Release Date | 2026-05-27 |
| Release Notes | Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 3 |
| Gene Designation | 20 |
| Allele Designation | 05 |
| Gene start | 161 |
| Gene end | 456 |
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2026-05-27 07:52:10 | Version 1 published Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGHV3-20*05 | IGHV3-20*05 | 1 | 2026-05-27 |