| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGHV7-81*02 |
| IUIS Name | IGHV7-81*02 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| SRX19354902 | V | Genbank | 1 | 476 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 217 |
| CDR1 End | 240 |
| CDR2 Start | 292 |
| CDR2 End | 315 |
| CDR3 Start | 430 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGACTGGACCTGGAGCATCCTCTTCTTGGTGGCAGCAGCAACAG |
| L-PART2 Start | 131 |
| L-PART2 End | 141 |
| L_PART2 | GTACCTACTCC |
| v_rs_start | 438 |
| v_rs_end | 476 |
| V_HEPTAMER | CACCATG |
| V_NONAMER | TCAGAAATC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A08715 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 1 |
| Release Date | 2026-05-27 |
| Release Notes | Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 7 |
| Gene Designation | 81 |
| Allele Designation | 02 |
| Gene start | 142 |
| Gene end | 437 |
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2026-05-27 07:52:10 | Version 1 published Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGHV7-81*02 | IGHV7-81*02 | 1 | 2026-05-27 |