Sequence IGHV1-8*02
Details
| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGHV1-8*02 |
| IUIS Name | IGHV1-8*02 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged Observations
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| MG719311 | Nonlocational | GenBank | 26 | 440 | ||
| HM855859 | Nonlocational | GenBank | 10 | 345 | ||
| HM855563 | Nonlocational | GenBank | 1 | 330 | ||
| SRX19354902 | V | Genbank | 1 | 478 |
Observations in AIRR-seq Repertoires
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR delineation
| CDR1 Start | 219 |
| CDR1 End | 242 |
| CDR2 Start | 294 |
| CDR2 End | 317 |
| CDR3 Start | 432 |
Non-Core Regions
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCTACAA |
| L-PART2 Start | 133 |
| L-PART2 End | 143 |
| L_PART2 | GTGCCCACTCC |
| v_rs_start | 440 |
| v_rs_end | 478 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | TCAGAAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
Extension
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
Additional Information
| Sequence ID | A02676 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 2 |
| Release Date | 2026-05-27 |
| Release Notes | Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 1 |
| Gene Designation | 8 |
| Allele Designation | 02 |
| Gene start | 144 |
| Gene end | 439 |
Notes
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
Attachments
History
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-07-10 11:24:36 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2026-05-27 07:52:08 | Version 2 published Repeat – had to roll back yesterday’s changes. Added genomic evidence from VDJbase study P25 (PMID37479682), including leaders/RSS for many sequences and additional alleles that currently have IUIS/IMGT names |
Changes from previous version
| v1 | v2 | |
|---|---|---|
| Curator address | Birkbeck College, University of London, Malet Street, London | Clareo Biosciences, Louisville, Kentucky, USA |
| Mapped | False | True |
| Inference Type | Unrearranged Only | Unrearranged |
| Full Sequence | ||
| Gene start | 127 | 144 |
| Gene end | 422 | 439 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 116 | 133 |
| L-PART2 End | 126 | 143 |
| CDR1 Start | 202 | 219 |
| CDR1 End | 225 | 242 |
| CDR2 Start | 277 | 294 |
| CDR2 End | 300 | 317 |
| CDR3 Start | 415 | 432 |
| v_rs_start | 423 | 440 |
| v_rs_end | 451 | 478 |
| curational_tags | likely_full-length | likely_full_length |
| Notes | changed |
Versions
All published versions of this sequence.
| Sequence Name | IMGT Name | Version | Date |
|---|---|---|---|
| IGHV1-8*02 | IGHV1-8*02 | 1 | 2023-07-10 |
| IGHV1-8*02 | IGHV1-8*02 | 2 | 2026-05-27 |