OGRDB

Details


Species	Macaca mulatta
Species subgroup
Subgroup type
Sequence Name	IGKV2-7TR6*10
IUIS Name
Alternative names
Affirmation Level	1
Full Sequence
Coding Sequence
Functionality	ORF
Inference Type	Unrearranged
Mapped	False
Paralogs
Paralog Rep	False

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

Accession	Type	Repository	Start	End	Coding Sequence	SC Coding Sequence
10.5281/zenodo.18156194 RGq13_h1tg000031l	V	VDJbase	480949	481741

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation


CDR1 Start	544
CDR1 End	576
CDR2 Start	628
CDR2 End	636
CDR3 Start	745

Non-Core Regions


UTR 5' Start
UTR 5' End
L-PART1 Start	1
L-PART1 End	51
L_PART1	ATGAGACTCCCTGCTCAGCTCCTTGGGCTGTTGATGCTCTGGGTCCCTGGT
L-PART2 Start	455
L-PART2 End	465
L_PART2	GATCCAGTGGG
v_rs_start	766
v_rs_end	793
V_HEPTAMER	CACAGGG
V_NONAMER	ACACAAACC
Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Extension


3' Extension
3' start
3' end
5' start
5' end

Additional Information


Sequence ID	A06057
Curator	William Lees
Curator address	Clareo Biosciences, Louisville, Kentucky, USA
Version	2
Release Date	2026-02-05
Release Notes	Fixed a problem with some sequences having the wrong coordinates for evidence annotation. This update does not change any sequences found in the FASTA or JSON reference sets, or the IgBLAST files derived from them.
Locus	IGK
Sequence Type	V
Gene Subgroup	2
Gene Designation	7TR6
Allele Designation	10
Gene start	466
Gene end	765

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.


Information for this sequence was imported into OGRDB via bulk update with the following notes: Notes from Digger annotation: V-HEPTAMER has variation at strongly conserved residue(s): ——-G- Additional information for this sequence was imported into OGRDB via bulk update with the following notes: Notes from Digger annotation: V-HEPTAMER has variation at strongly conserved residue(s): ——-G-

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Notes from Digger annotation: V-HEPTAMER has variation at strongly conserved residue(s): ——-G-

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Notes from Digger annotation: V-HEPTAMER has variation at strongly conserved residue(s): ——-G-

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.


William Lees 2026-01-06 16:44:24	Version 1 published First version of the rhesus macaque IGK germline set.


William Lees 2026-02-05 11:22:18	Version 2 published Fixed a problem with some sequences having the wrong coordinates for evidence annotation. This update does not change any sequences found in the FASTA or JSON reference sets, or the IgBLAST files derived from them.

Changes from previous version

	v1	v2
Gene start	63	466
Gene end	362	765
L-PART2 Start	52	455
L-PART2 End	62	465
CDR1 Start	141	544
CDR1 End	173	576
CDR2 Start	225	628
CDR2 End	233	636
CDR3 Start	342	745
v_rs_start	363	766
v_rs_end	390	793
Notes		changed

Versions

All published versions of this sequence.

Sequence Name	IMGT Name	Version	Date
IGKV2-7TR6*10		1	2026-01-06
IGKV2-7TR6*10		2	2026-02-05