Sequence IGKV2-3EAT*11
Details
| Species | Macaca mulatta |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGKV2-3EAT*11 |
| IUIS Name | |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | F |
| Inference Type | Unrearranged and rearranged |
| Mapped | False |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged Observations
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| 10.5281/zenodo.18156194 K916_h1tg000046l | V | VDJbase | 230687 | 231442 |
Observations in AIRR-seq Repertoires
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR delineation
| CDR1 Start | 505 |
| CDR1 End | 537 |
| CDR2 Start | 589 |
| CDR2 End | 597 |
| CDR3 Start | 706 |
Non-Core Regions
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 51 |
| L_PART1 | ATGAAGTTCCATGCTCAGCTCCTGGGACTGTTAATGCTCTGGGTCCCTGGT |
| L-PART2 Start | 416 |
| L-PART2 End | 426 |
| L_PART2 | GATCCAGTGGG |
| v_rs_start | 729 |
| v_rs_end | 756 |
| V_HEPTAMER | CACATTG |
| V_NONAMER | ACAGAAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
Extension
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
Additional Information
| Sequence ID | A06033 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 2 |
| Release Date | 2026-02-05 |
| Release Notes | Fixed a problem with some sequences having the wrong coordinates for evidence annotation. |
| Locus | IGK |
| Sequence Type | V |
| Gene Subgroup | 2 |
| Gene Designation | 3EAT |
| Allele Designation | 11 |
| Gene start | 427 |
| Gene end | 728 |
Notes
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
Attachments
History
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2026-01-06 16:44:23 | Version 1 published First version of the rhesus macaque IGK germline set. |
| William Lees 2026-02-05 11:22:15 | Version 2 published Fixed a problem with some sequences having the wrong coordinates for evidence annotation. |
Changes from previous version
| v1 | v2 | |
|---|---|---|
| Gene start | 63 | 427 |
| Gene end | 364 | 728 |
| L-PART2 Start | 52 | 416 |
| L-PART2 End | 62 | 426 |
| CDR1 Start | 141 | 505 |
| CDR1 End | 173 | 537 |
| CDR2 Start | 225 | 589 |
| CDR2 End | 233 | 597 |
| CDR3 Start | 342 | 706 |
| v_rs_start | 365 | 729 |
| v_rs_end | 392 | 756 |
| Notes | changed |
Versions
All published versions of this sequence.
| Sequence Name | IMGT Name | Version | Date |
|---|---|---|---|
| IGKV2-3EAT*11 | 1 | 2026-01-06 | |
| IGKV2-3EAT*11 | 2 | 2026-02-05 |