OGRDB

Details


Species	Macaca mulatta
Species subgroup
Subgroup type
Sequence Name	IGHV9-4SV6*10
IUIS Name
Alternative names
Affirmation Level	1
Full Sequence
Coding Sequence
Functionality	ORF
Inference Type	Unrearranged and rearranged
Mapped	False
Paralogs
Paralog Rep	False

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

Accession	Type	Repository	Start	End	Coding Sequence	SC Coding Sequence
10.5281/zenodo.18156194 K916_h1tg000625l	V	VDJbase	12243	12735

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation


CDR1 Start	232
CDR1 End	255
CDR2 Start	307
CDR2 End	336
CDR3 Start	451

Non-Core Regions


UTR 5' Start
UTR 5' End
L-PART1 Start	1
L-PART1 End	48
L_PART1	ATGGAGTTTGGGCTGAGCTGGATTTTCCTTGTTGCTATTCTAAAAGGT
L-PART2 Start	146
L-PART2 End	156
L_PART2	GTGTCCAGTGT
v_rs_start	455
v_rs_end	493
V_HEPTAMER	AACAGTG
V_NONAMER	ACACAAACC
Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Extension


3' Extension
3' start
3' end
5' start
5' end

Additional Information


Sequence ID	A05546
Curator	William Lees
Curator address	Clareo Biosciences, Louisville, Kentucky, USA
Version	2
Release Date	2026-02-05
Release Notes	Fixed a problem with some sequences having the wrong coordinates for evidence annotation. This update does not change any sequences found in the FASTA or JSON reference sets, or the IgBLAST files derived from them.
Locus	IGH
Sequence Type	V
Gene Subgroup	9
Gene Designation	4SV6
Allele Designation	10
Gene start	157
Gene end	454

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.


Information for this sequence was imported into OGRDB via bulk update with the following notes: Notes from Digger annotation: V-HEPTAMER has variation at strongly conserved residue(s): A——— Additional information for this sequence was imported into OGRDB via bulk update with the following notes: Notes from Digger annotation: V-HEPTAMER has variation at strongly conserved residue(s): A———

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Notes from Digger annotation: V-HEPTAMER has variation at strongly conserved residue(s): A———

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Notes from Digger annotation: V-HEPTAMER has variation at strongly conserved residue(s): A———

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.


William Lees 2026-01-06 16:42:48	Version 1 published First version of the macaque IGH germline set.


William Lees 2026-02-05 11:19:48	Version 2 published Fixed a problem with some sequences having the wrong coordinates for evidence annotation. This update does not change any sequences found in the FASTA or JSON reference sets, or the IgBLAST files derived from them.

Changes from previous version

	v1	v2
Gene start	60	157
Gene end	357	454
L-PART2 Start	49	146
L-PART2 End	59	156
CDR1 Start	135	232
CDR1 End	158	255
CDR2 Start	210	307
CDR2 End	239	336
CDR3 Start	354	451
v_rs_start	358	455
v_rs_end	396	493
Notes		changed

Versions

All published versions of this sequence.

Sequence Name	IMGT Name	Version	Date
IGHV9-4SV6*10		1	2026-01-06
IGHV9-4SV6*10		2	2026-02-05