| Species | Macaca mulatta |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGHV3-GYPG*22 |
| IUIS Name | |
| Alternative names | guo: IGHV3-141*02_W7216 |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | F |
| Inference Type | Unrearranged and rearranged |
| Mapped | False |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| 10.5281/zenodo.18156194 O3J_h1tg000022l | V | VDJbase | 561372 | 561862 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 232 |
| CDR1 End | 255 |
| CDR2 Start | 307 |
| CDR2 End | 330 |
| CDR3 Start | 445 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 48 |
| L_PART1 | ATGGAGTTTGGACTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGT |
| L-PART2 Start | 146 |
| L-PART2 End | 156 |
| L_PART2 | GTGTCCAGTGT |
| v_rs_start | 453 |
| v_rs_end | 491 |
| V_HEPTAMER | CACGGTG |
| V_NONAMER | ACACAAACG |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A04682 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 2 |
| Release Date | 2026-02-05 |
| Release Notes | Fixed a problem with some sequences having the wrong coordinates for evidence annotation. |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 3 |
| Gene Designation | GYPG |
| Allele Designation | 22 |
| Gene start | 157 |
| Gene end | 452 |
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2026-01-06 16:41:41 | Version 1 published First version of the macaque IGH germline set. |
| William Lees 2026-02-05 11:20:16 | Version 2 published Fixed a problem with some sequences having the wrong coordinates for evidence annotation. |
| v1 | v2 | |
|---|---|---|
| Gene start | 60 | 157 |
| Gene end | 355 | 452 |
| L-PART2 Start | 49 | 146 |
| L-PART2 End | 59 | 156 |
| CDR1 Start | 135 | 232 |
| CDR1 End | 158 | 255 |
| CDR2 Start | 210 | 307 |
| CDR2 End | 233 | 330 |
| CDR3 Start | 348 | 445 |
| v_rs_start | 356 | 453 |
| v_rs_end | 394 | 491 |
| Notes | changed |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGHV3-GYPG*22 | 1 | 2026-01-06 | |
| IGHV3-GYPG*22 | 2 | 2026-02-05 |