| Species | Macaca mulatta |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGKV3-ATHQ*28 |
| IUIS Name | |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | F |
| Inference Type | Unrearranged and rearranged |
| Mapped | False |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 141 |
| CDR1 End | 158 |
| CDR2 Start | 210 |
| CDR2 End | 218 |
| CDR3 Start | 327 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 51 |
| L_PART1 | ATGGAAGCCCCAGCACAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGGT |
| L-PART2 Start | 52 |
| L-PART2 End | 62 |
| L_PART2 | GAGGGGAATAT |
| v_rs_start | 350 |
| v_rs_end | 377 |
| V_HEPTAMER | GGGCAGG |
| V_NONAMER | TCATCTATG |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A06210 |
| Curator | William Lees |
| Curator address | Clareo Biosciences, Louisville, Kentucky, USA |
| Version | 1 |
| Release Date | 2026-01-06 |
| Release Notes | First version of the rhesus macaque IGK germline set. |
| Locus | IGK |
| Sequence Type | V |
| Gene Subgroup | 3 |
| Gene Designation | ATHQ |
| Allele Designation | 28 |
| Gene start | 63 |
| Gene end | 349 |
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2026-01-06 16:44:34 | Version 1 published First version of the rhesus macaque IGK germline set. |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGKV3-ATHQ*28 | 1 | 2026-01-06 | |
| IGKV3-ATHQ*28 | 2 | 2026-02-05 |