Species | Salmon |
Species subgroup | |
Subgroup type | |
Sequence Name | TRB2V1-1 |
IUIS Name | TRB2V1-1 |
Alternative names | TRB09V1-1 |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | P |
Inference Type | Genomic only |
Mapped | True |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
NC_059450.1 | GenBank | 48398140 | 48398720 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 79 |
CDR1 End | 99 |
CDR2 Start | 151 |
CDR2 End | 171 |
CDR3 Start | 283 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | |
L_PART1 | |
L-PART2 Start | 185 |
L-PART2 End | 247 |
L_PART2 | AGGTCTAACTGTGCCTAACTCTATTGATTTTATTCTCACTGTATCCTTAAAGGTCTTGTTGAG |
v_rs_start | 542 |
v_rs_end | 580 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACAAAAACC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A03083 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 1 |
Release Date | 2024-04-09 |
Release Notes | First release. |
Locus | TRB |
Sequence Type | V |
Gene Subgroup | V1 |
Gene Designation | 1 |
Allele Designation |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2024-04-09 08:28:19 | Version 1 published First release. |
All published versions of this sequence.
Sequence Name | IMGT Name | Alternative names | Inference Type | Affirmation Level | Species subgroup | Subgroup type | Gene start | Gene end | UTR 5' Start | UTR 5' End | L-PART1 Start | L-PART1 End | L-PART2 Start | L-PART2 End | CDR1 Start | CDR1 End | CDR2 Start | CDR2 End | CDR3 Start | v_rs_start | v_rs_end | d_rs_3_prime_start | d_rs_3_prime_end | d_rs_5_prime_start | d_rs_5_prime_end | j_rs_start | j_rs_end | Codon Frame | Version | Date |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TRB2V1-1 | TRB2V1-1 | TRB09V1-1 | Genomic only | 1 | 1 | 581 | 1 | 185 | 247 | 79 | 99 | 151 | 171 | 283 | 542 | 580 | 1 | 2024-04-09 |