Notes

The germline set is based on sequences published in Watson et al. (2019)

Details

AuthorWilliam Lees
Lab Name
Lab AddressBirkbeck College, University of London, Malet Street, London
NamePWD/PhJ IGH
SpeciesMouse
Species subgroupPWD/PhJ
Subgroup typestrain
LocusIGH
Release Version1
Release DescriptionThe germline set is based on sequences published in Watson et al. (2019)
Release Date2022-05-15

Included Sequences

LabelVnDateIMGT NameAlt NamesFunctionalitySubgrpSequenceGapped Sequence
IGHD-4V4R 12022-05-15IGHD4-1*02|Mus_musculus_BALB/cwatson_et_al:PWD_PhJ_IGHD4-1*02FPWD/PhJCAACTGGGACCAACTGGGAC
IGHD-7AYL 12022-05-15IGHD2-4*01|Mus_musculus_BALB/c,IGHD2-9*02|Mus_musculus_129/Svwatson_et_al:PWD_PhJ_IGHD2-4*01|IGHD2-9*02FPWD/PhJTCTACTATGATTACGACTCTACTATGATTACGAC
IGHD-F2TA 12022-05-15IGHD1-2*01|Mus_musculus_BALB/cwatson_et_al:PWD_PhJ_IGHD1-2*01FPWD/PhJTTCATTACTACGGCTACTTCATTACTACGGCTAC
IGHD-ISUV 12022-05-15IGHD3-2*01|Mus_musculus_BALB/cwatson_et_al:PWD_PhJ_IGHD3-2*01FPWD/PhJAGACAGCTCGGGCTACAGACAGCTCGGGCTAC
IGHD-QEGR 12022-05-15IGHD2-2*01|Mus_musculus_BALB/c,IGHD2-7*01|Mus_musculus_BALB/cwatson_et_al:PWD_PhJ_IGHD2-2*01|IGHD2-7*01FPWD/PhJTCTACTATGGTTACGACTCTACTATGGTTACGAC
IGHD-R4FS 12022-05-15IGHD4-1*01|Mus_musculus_BALB/cwatson_et_al:PWD_PhJ_IGHD4-1*01FPWD/PhJCTAACTGGGACCTAACTGGGAC
IGHD-TMGL 12022-05-15IGHD2-3*01|Mus_musculus_BALB/cwatson_et_al:PWD_PhJ_IGHD2-3*01FPWD/PhJTCTATGATGGTTACTACTCTATGATGGTTACTAC
IGHD-U6K7 12022-05-15watson_et_al:PWD_PhJ_IGHD2-12_varFPWD/PhJCCTACTATAGTTACTATAGTAACTACCCTACTATAGTTACTATAGTAACTAC
IGHD-VS5J 12022-05-15IGHD1-1*01|Mus_musculus_BALB/cwatson_et_al:PWD_PhJ_IGHD1-1*01FPWD/PhJTTTATTACTACGGTAGTAGCTACTTTATTACTACGGTAGTAGCTAC
IGHD-WHDL 12022-05-15IGHD2-1*01|Mus_musculus_129/Sv,IGHD2-8*01|Mus_musculus_BALB/cwatson_et_al:PWD_PhJ_IGHD2-1*01|IGHD2-8*01FPWD/PhJTCTACTATGGTAACTACTCTACTATGGTAACTAC
IGHJ-OE6Q 12022-05-15IGHJ1*03|Mus_musculus_A/Jwatson_et_al:PWD_PhJ_IGHJ1*03FPWD/PhJCTACTGGTACTTCGATGTCTGGGGCACAGGGACCACGGTCACCGTCTCCTCAGCTACTGGTACTTCGATGTCTGGGGCACAGGGACCACGGTCACCGTCTCCTCAG
IGHJ-RGEH 12022-05-15IGHJ3*01|Mus_musculuswatson_et_al:PWD_PhJ_IGHJ3*01FPWD/PhJCCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAGCCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAG
IGHJ-TVW6 12022-05-15IGHJ2*01|Mus_musculuswatson_et_al:PWD_PhJ_IGHJ2*02FPWD/PhJACTACTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAGACTACTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAG
IGHJ-WQBB 12022-05-15IGHJ4*01|Mus_musculuswatson_et_al:PWD_PhJ_IGHJ4*01FPWD/PhJATTACTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGATTACTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAG
IGHV-22ZX 12022-05-15watson_et_al:PWD_PhJ_IGHV9-2FPWD/PhJCAGATCCAGTTCGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGTGTATACCTTCACAGAATATCCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTCAAGTGGATGGGCTGGATAAACACCGACACTGGAGAGCCAACATATGCTGACGACTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCCAGATCCAGTTCGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGTGTATACCTTC............ACAGAATATCCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTCAAGTGGATGGGCTGGATAAACACCGAC......ACTGGAGAGCCAACATATGCTGACGACTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGC
IGHV-35YX 12022-05-15watson_et_al:PWD_PhJ_IGHV6-3FPWD/PhJGAGGTGAAGCTGGATGAGTCTGGTGGAGGCTTGGTGCAACCTGGGAGGTCCATGAAACTCTCCTGTGTTGCCTCTGGATTCACTTTTAGTGACTATTGGATGAACTGGGTCCACCAGTCTCCAGAGAAAGGACTGGAGTGGGTAGCACAAATTAGAAACAAACCTTATAATTATGTAACATATTATTCAGATTCTGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGAGCTGAAGACACGGGCATCTATTACTGTACGAGGTGAAGCTGGATGAGTCTGGTGGA...GGCTTGGTGCAACCTGGGAGGTCCATGAAACTCTCCTGTGTTGCCTCTGGATTCACTTTT............AGTGACTATTGGATGAACTGGGTCCACCAGTCTCCAGAGAAAGGACTGGAGTGGGTAGCACAAATTAGAAACAAACCTTATAATTATGTAACATATTATTCAGATTCTGTGAAA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGAGCTGAAGACACGGGCATCTATTACTGTAC
IGHV-37TR 12022-05-15watson_et_al:PWD_PhJ_IGHV1-2FPWD/PhJGAGATCCAGCTGCAGCAGTCTGGACCTGAGCTGGCGAGGCCTGGGGCTTCAGCGAAGATGTCCTGCAAGGCTTCTGGCTACACATTCACTGACTATGTTATGCACTGGGTGAAGCAGAAGCCTGGGCAGGGCCTTGAGTGGATTGGATATATTTATCCTTACACTGATGGTACTGAGTACAATGATAAGTTCAAAGGCAAGGCCACACTGACTTCAGAAAAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTACTGTGCAAGGAGATCCAGCTGCAGCAGTCTGGACCT...GAGCTGGCGAGGCCTGGGGCTTCAGCGAAGATGTCCTGCAAGGCTTCTGGCTACACATTC............ACTGACTATGTTATGCACTGGGTGAAGCAGAAGCCTGGGCAGGGCCTTGAGTGGATTGGATATATTTATCCTTAC......ACTGATGGTACTGAGTACAATGATAAGTTCAAA...GGCAAGGCCACACTGACTTCAGAAAAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTACTGTGCAAG
IGHV-3JRA 12022-05-15watson_et_al:PWD_PhJ_IGHV8-1FPWD/PhJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTCTGGTATGGGTGTGAGCTGGATTCGTCAGCCTTCAGGAAAGGGTCTGGAGTGGCTGGCACACATTTACTGGGATGATGACAAGCGCTATAACCCATCCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAGCAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCCAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTCTGGTATGGGTGTGAGCTGGATTCGTCAGCCTTCAGGAAAGGGTCTGGAGTGGCTGGCACACATTTACTGGGAT.........GATGACAAGCGCTATAACCCATCCCTGAAG...AGCCGGCTCACAATCTCCAAGGATACCTCCAGCAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGC
IGHV-3U4N 12022-05-15watson_et_al:PWD_PhJ_IGHV6-2FPWD/PhJGAGGTGAAGCTTGAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTAGCCTCTGGATTCACTTTCAGTAGCTACTGGATGGACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTGAAATTAGATTGAAATCTAATAATTATGCAACACATTATGCGGAGTCTGTGAAAGGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGAGCTGAAGACACTGGCATTTATTACTGTACGAGGTGAAGCTTGAGGAGTCTGGAGGA...GGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTAGCCTCTGGATTCACTTTC............AGTAGCTACTGGATGGACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTGAAATTAGATTGAAATCTAATAATTATGCAACACATTATGCGGAGTCTGTGAAA...GGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGAGCTGAAGACACTGGCATTTATTACTGTAC
IGHV-3UD7 12022-05-15watson_et_al:PWD_PhJ_IGHV8-8FPWD/PhJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCCTCCCAGACTCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTCTGGTATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCAAACATTTGGTGGGATGATGATAAGTACTATAACCCATCCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAAAAACCAGGTATTCCTCAAGATCGCCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCCAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCCTCCCAGACTCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTCTGGTATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCAAACATTTGGTGGGAT.........GATGATAAGTACTATAACCCATCCCTGAAG...AGCCGGCTCACAATCTCCAAGGATACCTCCAAAAACCAGGTATTCCTCAAGATCGCCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTC
IGHV-3W4V 12022-05-15watson_et_al:PWD_PhJ_IGHV8-3FPWD/PhJCAAGTTACTCTAAAAGAGTCTGGCCCTGGGATATTGAAGCCCTCACAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTACTAATATGGGTGTGAGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGGATGATGATAAGTACTATAACCCATCCCTGAAGAGCCGGCTAACAATCTCCAAGGATACCTCCAGAAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACTTACTACTGTGCTCCAAGTTACTCTAAAAGAGTCTGGCCCT...GGGATATTGAAGCCCTCACAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTACTAATATGGGTGTGAGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGGAT.........GATGATAAGTACTATAACCCATCCCTGAAG...AGCCGGCTAACAATCTCCAAGGATACCTCCAGAAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACTTACTACTGTGCTC
IGHV-4K6F 12022-05-15IGHV11-2*01|Mus_musculus_C57BL/6watson_et_al:PWD_PhJ_IGHV11-1FPWD/PhJGAAGTGCAGCTGTTGGAGACTGGAGGAGGCTTGGTGCAACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTTAGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGATGGCAGTGCAATAAACTACGCACCATCCATAAAGGATCGATTCACTATCTTCAGAGACAATGACAAGAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCGGAGGACACAGCCACGTATTTCTGTATGAAGTGCAGCTGTTGGAGACTGGAGGA...GGCTTGGTGCAACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTT............AGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGAT......GGCAGTGCAATAAACTACGCACCATCCATAAAG...GATCGATTCACTATCTTCAGAGACAATGACAAGAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCGGAGGACACAGCCACGTATTTCTGTAT
IGHV-57QL 12022-05-15watson_et_al:PWD_PhJ_IGHV3-2FPWD/PhJGAGGTGCAGCTTCAGGAGTCAGGACCTGGCCTGGTGAAACCTTCTCAGACTCTGTCCCTCACCTGTTCTGTCACTGGCTACTCCATCACCAGTGATTACTGGAACTGGATCCGGAAATTCCCAGGGAATAAACTTGAGTACATGGGGTACATAAGCTACAGTGGTAGCACTAACTACAATCCATCTCTCAAAAGTCGAATCTCCATCACTCGAGACACATCCAAGAACCAGTACTACCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCAAGAGAGGTGCAGCTTCAGGAGTCAGGACCT...GGCCTGGTGAAACCTTCTCAGACTCTGTCCCTCACCTGTTCTGTCACTGGCTACTCCATC............ACCAGTGATTACTGGAACTGGATCCGGAAATTCCCAGGGAATAAACTTGAGTACATGGGGTACATAAGCTACAGT.........GGTAGCACTAACTACAATCCATCTCTCAAA...AGTCGAATCTCCATCACTCGAGACACATCCAAGAACCAGTACTACCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCAAGA
IGHV-5ETG 12022-05-15watson_et_al:PWD_PhJ_IGHV1-27FPWD/PhJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACTCCTTCACCAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGCATGATTCATCCTTCCGATAGTGAAACTAGGTTAAATCAGAAGTTCAAGGACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCCGACATCTGAGGACTCTGCGGTCTATTACTGTCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACTCCTTC............ACCAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGCATGATTCATCCTTCC......GATAGTGAAACTAGGTTAAATCAGAAGTTCAAG...GACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCCGACATCTGAGGACTCTGCGGTCTATTACTGT
IGHV-5LEV 12022-05-15IGHV1-69*02|Mus_musculus_BALB/cwatson_et_al:PWD_PhJ_IGHV1-26FPWD/PhJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATCGGAGAGATTGATCCTTCTGATAGTTATACTAACTACAATCAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAACAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATCGGAGAGATTGATCCTTCT......GATAGTTATACTAACTACAATCAAAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAA
IGHV-5MIJ 12022-05-15watson_et_al:PWD_PhJ_IGHV5-9FPWD/PhJGAAGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAACCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATTACATGTCTTGGGTTCGCCAGACTCCGGAAAAGAGGCTGGAGTGGGTCGCAACCATTAGTGATGGTGGTAGTTACACCTACTATCCAGACAGTGTAAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACCTGGCCATGTATTACTGTGCGAAGTGAAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAACCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATTACATGTCTTGGGTTCGCCAGACTCCGGAAAAGAGGCTGGAGTGGGTCGCAACCATTAGTGATGGT......GGTAGTTACACCTACTATCCAGACAGTGTAAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACCTGGCCATGTATTACTGTGC
IGHV-5RPF 12022-05-15watson_et_al:PWD_PhJ_IGHV8-6FPWD/PhJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCCTCCCAGACCCTCAGTCTAACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTCTGGTATGAGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGAATGATGATAAGTACTATAACCCAGCCCTGAAAAGCCGGCTCACAATCTCCAAGGATACCTCCAACAACCAGGTATTCCTCAAGATCGCCAGTGTGGTCACTGCAGATACTGCCACATACTACTGTGCTCCAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCCTCCCAGACCCTCAGTCTAACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTCTGGTATGAGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGAAT.........GATGATAAGTACTATAACCCAGCCCTGAAA...AGCCGGCTCACAATCTCCAAGGATACCTCCAACAACCAGGTATTCCTCAAGATCGCCAGTGTGGTCACTGCAGATACTGCCACATACTACTGTGCTC
IGHV-5UGX 12022-05-15watson_et_al:PWD_PhJ_IGHV1-3FPWD/PhJCAGGTTCAACTGCAGCAGTCTGGGGCTGAGCTGGTGAGGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCGGGCTACACATTTACCAGTTACAATATGCACTGGGTGAAGCAGACAACTGTGCATGGCCTGGAATGGATTGGAGCTATTCATCCTGGAAGTGGTGGTACTGCCTACAATCAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGACATCTGAGGACTCTGCCGTCTATTACTGTCAGGTTCAACTGCAGCAGTCTGGGGCT...GAGCTGGTGAGGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCGGGCTACACATTT............ACCAGTTACAATATGCACTGGGTGAAGCAGACAACTGTGCATGGCCTGGAATGGATTGGAGCTATTCATCCTGGA......AGTGGTGGTACTGCCTACAATCAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGACATCTGAGGACTCTGCCGTCTATTACTGT
IGHV-5YZ7 12022-05-15IGHV7-4*01|Mus_musculus_C57BL/6watson_et_al:PWD_PhJ_IGHV7-2FPWD/PhJGAGGTGAAGCTGATGGAATCTGGAGGAGGCTTGGTACAGCCTGGGGCTTCTCTGAGACTCTCCTGTGCAGCTTCTGGATTCACCTTTACTGATTACTACATGAGCTGGGTCCGCCAGCCTCCAGGGAAGGCACCTGAGTGGTTGGCTTTGATTAGAAACAAAGCTAATGGTTACACAACAGAGTATACTGCATCTGTTAAGGGTCGGTTCACCATCTCCAGAGATAATTCCCAAAACATCCTCTATCTTCAAATGAACACCCTGAGGGCTGAGGACAGTGCCACTTATTACTGTGTAAAAGCGAGGTGAAGCTGATGGAATCTGGAGGA...GGCTTGGTACAGCCTGGGGCTTCTCTGAGACTCTCCTGTGCAGCTTCTGGATTCACCTTT............ACTGATTACTACATGAGCTGGGTCCGCCAGCCTCCAGGGAAGGCACCTGAGTGGTTGGCTTTGATTAGAAACAAAGCTAATGGTTACACAACAGAGTATACTGCATCTGTTAAG...GGTCGGTTCACCATCTCCAGAGATAATTCCCAAAACATCCTCTATCTTCAAATGAACACCCTGAGGGCTGAGGACAGTGCCACTTATTACTGTGTAAAAGC
IGHV-5ZAK 12022-05-15IGHV7-3*01|Mus_musculus_C57BL/6watson_et_al:PWD_PhJ_IGHV7-1FPWD/PhJGAGGTGAAGCTGGTGGAGTCTGGAGGAGGCTTGGTACAGCCTGGGGGTTCTCTGAGTCTCTCCTGTGCAGCTTCTGGATTCACCTTCACTGATTACTACATGAGCTGGGTCCGCCAGCCTCCAGGGAAGGCACTTGAGTGGTTGGGTTTTATTAGAAACAAAGCTAATGGTTACACAACAGAGTACAGTGCATCTGTGAAGGGTCGGTTCACCATCTCCAGAGATAATTCCCAAAGCATCCTCTATCTTCAAATGAATGCCCTGAGAGCTGAGGACAGTGCCACTTATTACTGTGCGAGGTGAAGCTGGTGGAGTCTGGAGGA...GGCTTGGTACAGCCTGGGGGTTCTCTGAGTCTCTCCTGTGCAGCTTCTGGATTCACCTTC............ACTGATTACTACATGAGCTGGGTCCGCCAGCCTCCAGGGAAGGCACTTGAGTGGTTGGGTTTTATTAGAAACAAAGCTAATGGTTACACAACAGAGTACAGTGCATCTGTGAAG...GGTCGGTTCACCATCTCCAGAGATAATTCCCAAAGCATCCTCTATCTTCAAATGAATGCCCTGAGAGCTGAGGACAGTGCCACTTATTACTGTGC
IGHV-67UK 12022-05-15watson_et_al:PWD_PhJ_IGHV9-3FPWD/PhJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCCGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGCTATACCTTCACAAACTATGCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATATACACCAACACTGGAGAGCCAACATATGCTGAAGAGTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGCCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCCGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGCTATACCTTC............ACAAACTATGCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATATACACCAAC......ACTGGAGAGCCAACATATGCTGAAGAGTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGC
IGHV-6EQK 12022-05-15watson_et_al:PWD_PhJ_IGHV1-34FPWD/PhJCAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTCACAAGCTACGATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTAGAGATGGTAGTACTAAGTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTACAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGGCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCACAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACAAGCTACGATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTAGA......GATGGTAGTACTAAGTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTACAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGGCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCA
IGHV-6SEN 12022-05-15watson_et_al:PWD_PhJ_IGHV1-14FPWD/PhJGAGATCCAGCTGCAGCAGTCTGGACCTGAGCTGGTCAAGCCTGGGGCTTCAGTGAAGATATCATGCAAGGCTTCTGGTTACTCATTCACTGGCTACTACATGCACTGGGTGAAGCAAAGTCCTGAAAAGAGCCTTGAGTGGATTGGAGAGATTAATCCTAGCACTGGTGGTACTACCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAAGAGCCTGACATCTGAGTACTCTGCAGTCTATTACTGTGCAAGAGATCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTCAAGCCTGGGGCTTCAGTGAAGATATCATGCAAGGCTTCTGGTTACTCATTC............ACTGGCTACTACATGCACTGGGTGAAGCAAAGTCCTGAAAAGAGCCTTGAGTGGATTGGAGAGATTAATCCTAGC......ACTGGTGGTACTACCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAAGAGCCTGACATCTGAGTACTCTGCAGTCTATTACTGTGCAA
IGHV-7MXA 12022-05-15watson_et_al:PWD_PhJ_IGHV2-5FPWD/PhJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCCCAGAGCCTGTCCATCACATGCACTGTCTCAGGGTTCTCATTAACCAGCTATGGTGTAGACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGGTGGAAGCACAAATTATAATTCAGCTCTCAAATCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCACGTACTACTGTGCCACAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCCCAGAGCCTGTCCATCACATGCACTGTCTCAGGGTTCTCATTA............ACCAGCTATGGTGTAGACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGGT.........GGAAGCACAAATTATAATTCAGCTCTCAAA...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCACGTACTACTGTGCCA
IGHV-AAHA 12022-05-15watson_et_al:PWD_PhJ_IGHV1-41FPWD/PhJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACTTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTTATCCTGGTAGTGGTAGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAATCCTCTAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACTTTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTTATCCTGGT......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACAAATCCTCTAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGT
IGHV-AFC4 12022-05-15watson_et_al:PWD_PhJ_IGHV8-2FPWD/PhJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTCTGGTATGGGTGTGAGCTGGATTCGTCAGCCTTCAGGAAAGGGTCTGGAGTGGCTGGCACACATTTACTGGGATGATGACAAGCGCTATAACCCATCCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAGAAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCGCAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTCTGGTATGGGTGTGAGCTGGATTCGTCAGCCTTCAGGAAAGGGTCTGGAGTGGCTGGCACACATTTACTGGGAT.........GATGACAAGCGCTATAACCCATCCCTGAAG...AGCCGGCTCACAATCTCCAAGGATACCTCCAGAAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCG
IGHV-AH6Q 12022-05-15watson_et_al:PWD_PhJ_IGHV1-1FPWD/PhJCAGATACAGCTGCAACAGTCAGGAGCTGAGCTGGCGAGTCCTGGGGCATCAGTGACACTGTCCTGCAAGGCTTCTGGCTACACATTTACTGACCATATTATGAATTGGGTAAAAAAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAAGGATTTATCCAGTAAGTGGTGAAACTAACTACAATCAAAAGTTCATGGGCAAGGCCACATTCTCTGTAGACCGGTCCTCCAGCACAGTGTACATGGTGTTGAACAGCCTGACATCTGAGGACCCTGCTGTCTATTACTGTGCAACAGATACAGCTGCAACAGTCAGGAGCT...GAGCTGGCGAGTCCTGGGGCATCAGTGACACTGTCCTGCAAGGCTTCTGGCTACACATTT............ACTGACCATATTATGAATTGGGTAAAAAAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAAGGATTTATCCAGTA......AGTGGTGAAACTAACTACAATCAAAAGTTCATG...GGCAAGGCCACATTCTCTGTAGACCGGTCCTCCAGCACAGTGTACATGGTGTTGAACAGCCTGACATCTGAGGACCCTGCTGTCTATTACTGTGCAA
IGHV-AWHJ 12022-05-15watson_et_al:PWD_PhJ_IGHV1-6FPWD/PhJGAGGTCCAGCTGCAGCAGTCTGGACCTGTGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTCACTGACTACAACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACTTGTTAATCCTAGCACTGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTTGACAAGTCCTCCAGCACAGCCTACATGGAGCTCAACAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGGAGGTCCAGCTGCAGCAGTCTGGACCT...GTGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTC............ACTGACTACAACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACTTGTTAATCCTAGC......ACTGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTTGACAAGTCCTCCAGCACAGCCTACATGGAGCTCAACAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTG
IGHV-BRO6 12022-05-15watson_et_al:PWD_PhJ_IGHV1-18FPWD/PhJCAGGTCCAACTGCAGCAGCCTGGGGCTGAACTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCAACTGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTTATCCTGGTAGTGGTAGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCCAGGTCCAACTGCAGCAGCCTGGGGCT...GAACTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCAACTGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTTATCCTGGT......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGC
IGHV-C53X 12022-05-15watson_et_al:PWD_PhJ_IGHV5-1FPWD/PhJGAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCTCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATTACATGTCTTGGGTTCGGCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAATACTGGTGGTAGCACCTACTATCCAGACACTGTGAAGGGGCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAATTCTGAGGACACAGCCGTGTATTACTGTGCAGAAGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCTCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATTACATGTCTTGGGTTCGGCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAATACT......GGTGGTAGCACCTACTATCCAGACACTGTGAAG...GGGCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAATTCTGAGGACACAGCCGTGTATTACTGTGCA
IGHV-CE5S 12022-05-15watson_et_al:PWD_PhJ_IGHV9-4FPWD/PhJCAGATCCAGTTGGTGCAGTCTGGATCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAAACTATGGAATGAACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCTACACTGGAGTGCCAACATATGCTGACGACTTCAAGGGACGGTTTGCCTTTTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCCAGATCCAGTTGGTGCAGTCTGGATCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACAAACTATGGAATGAACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCTAC......ACTGGAGTGCCAACATATGCTGACGACTTCAAG...GGACGGTTTGCCTTTTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGC
IGHV-CJFW 12022-05-15IGHV1-63*01|Mus_musculus_C57BL/6watson_et_al:PWD_PhJ_IGHV1-21FPWD/PhJCAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTAAGGCCTGGGACTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACCTTCACTAACTACTGGATAGGTTGGGCAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGATATTTACCCTGGAGGTGGTTATACTAACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGTTCAGCAGCCTGACATCTGAGGACTCTGCCATCTATTACTGTGCAAGCAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTAAGGCCTGGGACTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACCTTC............ACTAACTACTGGATAGGTTGGGCAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGATATTTACCCTGGA......GGTGGTTATACTAACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGTTCAGCAGCCTGACATCTGAGGACTCTGCCATCTATTACTGTGCAAG
IGHV-D7IW 12022-05-15watson_et_al:PWD_PhJ_IGHV1-11FPWD/PhJGAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGACTTCTGGTTACTCATTCACTGGCTACTACATGCACTGGGTGAAGCAGAGCCATGGAAATAGCCTCGATTGGATTGGATATATTTATCCTTACAATGGTGTTTCTAGCTACAACCAGAAATTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCTAGCACAGCCTTCATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGGAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGACTTCTGGTTACTCATTC............ACTGGCTACTACATGCACTGGGTGAAGCAGAGCCATGGAAATAGCCTCGATTGGATTGGATATATTTATCCTTAC......AATGGTGTTTCTAGCTACAACCAGAAATTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCTAGCACAGCCTTCATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAG
IGHV-DDST 12022-05-15watson_et_al:PWD_PhJ_IGHV5-11FPWD/PhJGAAGTGATGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGGCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTTGGTCGCAGCCATTAATAGTAATGGTGGTAGCACCTACTATCCAGACACTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATGTACTACTGTGCGAAGTGATGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATGGCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTTGGTCGCAGCCATTAATAGTAAT......GGTGGTAGCACCTACTATCCAGACACTGTGAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATGTACTACTGTGC
IGHV-DTV7 12022-05-15watson_et_al:PWD_PhJ_IGHV1-20FPWD/PhJAAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTGAAACCCGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACTGAGTATACTATACACTGGGTAAAGCAGAGGACTGGACAGGGTCTTGAGTGGATTGGGTGGTTTTACCCTGGAAGTGGTAGTATAAAGTACAATGAGAAATTCAAGGACAAGGCCACATTGACTGCGGACAAATCCTCCAGCACAGTCTATATGGAGCTTAGTAGATTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGACACGAAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTGAAACCCGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACTGAGTATACTATACACTGGGTAAAGCAGAGGACTGGACAGGGTCTTGAGTGGATTGGGTGGTTTTACCCTGGA......AGTGGTAGTATAAAGTACAATGAGAAATTCAAG...GACAAGGCCACATTGACTGCGGACAAATCCTCCAGCACAGTCTATATGGAGCTTAGTAGATTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGACACG
IGHV-F6YN 12022-05-15watson_et_al:PWD_PhJ_IGHV1-15FPWD/PhJCAGGTTCAGCTGCAGCAGTCTGGGGCTGAGCTAGTGAAGCCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTCACTACCTATCCTATAGAGTGGATGAAGCAGAATCATGGAAAGAGCCTAGAGTGGATTGGAAATTTTCATCCTTACAATGATGATACTAAGTACAATGAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGAAAAATCCTCTAGCACTGTCTACTTGGAGCTCAGTCGATTAACATCTGATGACTCTGCTGTTTATTACTGTGCAAGGCAGGTTCAGCTGCAGCAGTCTGGGGCT...GAGCTAGTGAAGCCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTC............ACTACCTATCCTATAGAGTGGATGAAGCAGAATCATGGAAAGAGCCTAGAGTGGATTGGAAATTTTCATCCTTAC......AATGATGATACTAAGTACAATGAAAAGTTCAAG...GGCAAGGCCACATTGACTGTAGAAAAATCCTCTAGCACTGTCTACTTGGAGCTCAGTCGATTAACATCTGATGACTCTGCTGTTTATTACTGTGCAAGG
IGHV-FGSI 12022-05-15watson_et_al:PWD_PhJ_IGHV1-22FPWD/PhJCAGGTCCAACTGCAGCAGCCTGGGGCTGAACTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACTTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAATGATTCATCCTAATAGTGGTAGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCCAGGTCCAACTGCAGCAGCCTGGGGCT...GAACTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACTTTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAATGATTCATCCTAAT......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGC
IGHV-FNOE 12022-05-15watson_et_al:PWD_PhJ_IGHV1-39FPWD/PhJCAGGTCCAACTGCAGCAGCCTGGGTCTGTGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTCCTGGATGCACTGGGCGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGAGATTCATCCTAATAGTGGTAATACTAACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACGTGGATCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAAGCAGGTCCAACTGCAGCAGCCTGGGTCT...GTGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTCCTGGATGCACTGGGCGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGAGATTCATCCTAAT......AGTGGTAATACTAACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACGTGGATCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAAG
IGHV-FRUS 12022-05-15watson_et_al:PWD_PhJ_IGHV1-7FPWD/PhJGAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTTACTGGCTACTTTATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACGTATTAATCCTTACAATGGTGATACTTTCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCTAGCACAGCCCACATGGAGCTCCGGAGCCTGACATCTGAGGACTCTGCACTCTATTATTGTGCAAGGAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTT............ACTGGCTACTTTATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACGTATTAATCCTTAC......AATGGTGATACTTTCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCTAGCACAGCCCACATGGAGCTCCGGAGCCTGACATCTGAGGACTCTGCACTCTATTATTGTGCAAG
IGHV-G2GM 12022-05-15watson_et_al:PWD_PhJ_IGHV1-28FPWD/PhJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGCATGATTCATCCTTCCGATAGTGAAACTAGGTTAAATCAGAAGTTCAAGGACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCCGACATCTGAGGACTCTGCGGTCTATTACTGTGCACAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGCATGATTCATCCTTCC......GATAGTGAAACTAGGTTAAATCAGAAGTTCAAG...GACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCCGACATCTGAGGACTCTGCGGTCTATTACTGTGCA
IGHV-GDWR 12022-05-15watson_et_al:PWD_PhJ_IGHV8-7FPWD/PhJCAGGTTACTCTGAAAGAGTCGGGCCCTGGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTCTGGTATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCAAACATTTGGTGGGATGATAGTAAGTACTATAACGCAGCCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAAAAACCAGGTATTCCTCAAGATCGCCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCCAGGTTACTCTGAAAGAGTCGGGCCCT...GGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTCTGGTATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCAAACATTTGGTGGGAT.........GATAGTAAGTACTATAACGCAGCCCTGAAG...AGCCGGCTCACAATCTCCAAGGATACCTCCAAAAACCAGGTATTCCTCAAGATCGCCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGC
IGHV-GIJT 12022-05-15IGHV6-3*01|Mus_musculus_C57BL/6watson_et_al:PWD_PhJ_IGHV6-1FPWD/PhJGAAGTGAAGCTTGAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTTGCCTCTGGATTCACTTTCAGTAACTACTGGATGAACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTCAAATTAGATTGAAATCTGATAATTATGCAACACATTATGCGGAGTCTGTGAAAGGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGGGCTGAAGACACTGGAATTTATTACTGCGAAGTGAAGCTTGAGGAGTCTGGAGGA...GGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTTGCCTCTGGATTCACTTTC............AGTAACTACTGGATGAACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTCAAATTAGATTGAAATCTGATAATTATGCAACACATTATGCGGAGTCTGTGAAA...GGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGGGCTGAAGACACTGGAATTTATTACTGC
IGHV-GRZR 12022-05-15watson_et_al:PWD_PhJ_IGHV10-1FPWD/PhJGAGGTGCAGCTTGTTGAGACTGGTGGAGGATTGGTGCAGCCTAAAGGGTCATTGAAACTCTCATGTGCAGCCTCTGGATTCAGCTTCAATACCAATGCCATGAACTGGGTCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTAATAATTATGCAACATATTATGCCGATTCAGTGAAAGACAGGTTCACCATCTCCAGAGATGATTCACAAAGCATGCTCTATCTGCAAATGAACAACTTGAAAACTGAGGACACAGCCATGTATTACTGTGTGAGGTGCAGCTTGTTGAGACTGGTGGA...GGATTGGTGCAGCCTAAAGGGTCATTGAAACTCTCATGTGCAGCCTCTGGATTCAGCTTC............AATACCAATGCCATGAACTGGGTCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTAATAATTATGCAACATATTATGCCGATTCAGTGAAA...GACAGGTTCACCATCTCCAGAGATGATTCACAAAGCATGCTCTATCTGCAAATGAACAACTTGAAAACTGAGGACACAGCCATGTATTACTGTGT
IGHV-HH7J 12022-05-15watson_et_al:PWD_PhJ_IGHV3-1FPWD/PhJGATGTGCAGCTTCAGGAGTCAGGACCTGGCCTCGTGAAACCTTCTCAGTCTCTGTCTCTCACCTGCTCTGTCACTGGCTACTCCATCACCAGTGGTTATTACTGGCACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGATACATAAGCTACAGTGGTAGCACTAACTACAACCCATCTCTCAAAAATCGAATCTCCATCACTCATGACACATCTAAGAACCAGTTCTTCCTGAAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTATTGTGCAGATGTGCAGCTTCAGGAGTCAGGACCT...GGCCTCGTGAAACCTTCTCAGTCTCTGTCTCTCACCTGCTCTGTCACTGGCTACTCCATCACC.........AGTGGTTATTACTGGCACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGATACATAAGCTACAGT.........GGTAGCACTAACTACAACCCATCTCTCAAA...AATCGAATCTCCATCACTCATGACACATCTAAGAACCAGTTCTTCCTGAAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTATTGTGCA
IGHV-IM3C 12022-05-15IGHV2-9-1*01|Mus_musculus_C57BL/6watson_et_al:PWD_PhJ_IGHV2-7FPWD/PhJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCTGGGTTCTCATTAACCAGCTATGCTATAAGCTGGGTTCGCCAGCCACCAGGAAAGGGTCTGGAGTGGCTTGGAGTAATATGGACTGGTGGAGGCACAAATTATAATTCAGCTCTCAAATCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGTCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCAGGTACTACTGTGCCCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCTGGGTTCTCATTA............ACCAGCTATGCTATAAGCTGGGTTCGCCAGCCACCAGGAAAGGGTCTGGAGTGGCTTGGAGTAATATGGACTGGT.........GGAGGCACAAATTATAATTCAGCTCTCAAA...TCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGTCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCAGGTACTACTGTGCC
IGHV-IXUZ 12022-05-15watson_et_al:PWD_PhJ_IGHV1-40FPWD/PhJCAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGACTTCTGGCTACACCTTCACCAGCTACTGGATTCAGTGGGTAAAACAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAGTGATATTTCCTGGAACTGGTACTACTTACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTATAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACCTCTGAGGACTCTGCTGTCTATTTCTGTGCAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGACTTCTGGCTACACCTTC............ACCAGCTACTGGATTCAGTGGGTAAAACAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAGTGATATTTCCTGGA......ACTGGTACTACTTACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTATAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACCTCTGAGGACTCTGCTGTCTATTTCTGTG
IGHV-JC5L 12022-05-15watson_et_al:PWD_PhJ_IGHV1-9FPWD/PhJGAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTCACTCACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGAAATTAATCCTTACGATGGTAGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGGAGGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTC............ACTCACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGAAATTAATCCTTAC......GATGGTAGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTG
IGHV-JEOG 12022-05-15watson_et_al:PWD_PhJ_IGHV5-4FPWD/PhJGAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTATTACATGTATTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTTGCAGAAATTAGTAGTGGTGGTGGTAACACCTACTATCCAGACAGTGTGAAGGGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATGTATTACTGTGCAGAAGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTGACTATTACATGTATTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTTGCAGAAATTAGTAGTGGT......GGTGGTAACACCTACTATCCAGACAGTGTGAAG...GGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATGTATTACTGTGCA
IGHV-KD4A 12022-05-15watson_et_al:PWD_PhJ_IGHV4-1FPWD/PhJGAGGTGAAGCTTCTCGAGTCTGGAGGTGGCCTGGTGCAGCCTGGAGGATCCCTGAAACTCTCCTGTGCAGCCTCAGGATTCGATTTTAGTAGATACTGGATGAGTTGGGTCCGGCAGGCTCCAGGGAAAGGGCTAGAATGGATTGGAGAAATTAATCCAGGTAGCAGTACGATAAACTATGCACCATCTCTAAAGGATAAATTCATCATCTCCAGAGACAATGCCAAAAATACGCTGTACCTGCAAATGAGCAAAGTGAGATCTGAGGACACAGCCCTTTATTACTGTGCGAGGTGAAGCTTCTCGAGTCTGGAGGT...GGCCTGGTGCAGCCTGGAGGATCCCTGAAACTCTCCTGTGCAGCCTCAGGATTCGATTTT............AGTAGATACTGGATGAGTTGGGTCCGGCAGGCTCCAGGGAAAGGGCTAGAATGGATTGGAGAAATTAATCCAGGT......AGCAGTACGATAAACTATGCACCATCTCTAAAG...GATAAATTCATCATCTCCAGAGACAATGCCAAAAATACGCTGTACCTGCAAATGAGCAAAGTGAGATCTGAGGACACAGCCCTTTATTACTGTGC
IGHV-KXC4 12022-05-15watson_et_al:PWD_PhJ_IGHV1-25FPWD/PhJCAGGTCCAACTGCAGCAGCCTGGGGCTGAAATTGTGAGGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTTACCGACTATTGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATCGGAGCAATTGATCCTTCTGATAGTTATACTAGCTACAATCAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGACACATCCTCCAGCTCAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCAAGCAGGTCCAACTGCAGCAGCCTGGGGCT...GAAATTGTGAGGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTT............ACCGACTATTGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATCGGAGCAATTGATCCTTCT......GATAGTTATACTAGCTACAATCAAAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACACATCCTCCAGCTCAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCAAG
IGHV-L2XC 12022-05-15watson_et_al:PWD_PhJ_IGHV8-5FPWD/PhJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTCTGGTATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGGATGATGTCAAGCGCTATAACCCAGCCCTGAAGAGCCGACTGACTATCTCCAAGGATACCTCCAGCAGCCAGGTATTCCTCAAGATCGCCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCGACAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTCTGGTATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGGAT.........GATGTCAAGCGCTATAACCCAGCCCTGAAG...AGCCGACTGACTATCTCCAAGGATACCTCCAGCAGCCAGGTATTCCTCAAGATCGCCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCGA
IGHV-LDXW 12022-05-15watson_et_al:PWD_PhJ_IGHV2-4FPWD/PhJCAGGTGCAGCTGAAGGAGTCAGGACCTGACCTTGTGCAGCCCTCACAGACCCTGTCTCTCACCTGCACTGTCTCTGGGTTCTCATTAACCAGCTATGGTGTTCACTGGGTTCGCCAGCCTCCAGGAAAGGGACTGGAGTGGGTGGGAACAATGGGCTGGGATGACAAAAAATATTATAATTCAGCTCTAAAATCTCGACTGAGCATCAGCAGGGATACCTCCAAGAACCAAGTTTTCTTAAAACTGAGCAGTCTGCAAACTGAAGACACAGCCATGTACTACTGTCAGGTGCAGCTGAAGGAGTCAGGACCT...GACCTTGTGCAGCCCTCACAGACCCTGTCTCTCACCTGCACTGTCTCTGGGTTCTCATTA............ACCAGCTATGGTGTTCACTGGGTTCGCCAGCCTCCAGGAAAGGGACTGGAGTGGGTGGGAACAATGGGCTGGGAT.........GACAAAAAATATTATAATTCAGCTCTAAAA...TCTCGACTGAGCATCAGCAGGGATACCTCCAAGAACCAAGTTTTCTTAAAACTGAGCAGTCTGCAAACTGAAGACACAGCCATGTACTACTGT
IGHV-LF2W 12022-05-15IGHV1-9*01|Mus_musculus_C57BL/6watson_et_al:PWD_PhJ_IGHV1-35FPWD/PhJCAGGTTCAGCTGCAGCAGTCTGGAGCTGAGCTGATGAAGCCTGGGGCCTCAGTGAAGCTTTCCTGCAAGGCTACTGGCTACACATTCACTGGCTACTGGATAGAGTGGGTAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGAGATTTTACCTGGAAGTGGTAGTACTAACTACAATGAGAAGTTCAAGGGCAAGGCCACATTCACTGCAGATACATCCTCCAACACAGCCTACATGCAACTCAGCAGCCTGACAACTGAGGACTCTGCCATCTATTACTGTGCCAGGTTCAGCTGCAGCAGTCTGGAGCT...GAGCTGATGAAGCCTGGGGCCTCAGTGAAGCTTTCCTGCAAGGCTACTGGCTACACATTC............ACTGGCTACTGGATAGAGTGGGTAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGAGATTTTACCTGGA......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...GGCAAGGCCACATTCACTGCAGATACATCCTCCAACACAGCCTACATGCAACTCAGCAGCCTGACAACTGAGGACTCTGCCATCTATTACTGTGC
IGHV-MJU4 12022-05-15IGHV2-2*01|Mus_musculus_C57BL/6watson_et_al:PWD_PhJ_IGHV2-1FPWD/PhJCAGGTGCAGCTGAAGCAGTCAGGACCTGGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTAACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGTGGAAGCACAGACTATAATGCAGCTTTCATATCCAGACTGAGCATCAGCAAGGACAATTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATATTACTGTGCCAGGTGCAGCTGAAGCAGTCAGGACCT...GGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTA............ACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGT.........GGAAGCACAGACTATAATGCAGCTTTCATA...TCCAGACTGAGCATCAGCAAGGACAATTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATATTACTGTGC
IGHV-MLJ2 12022-05-15watson_et_al:PWD_PhJ_IGHV1-24FPWD/PhJCAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACAGCTTCACAAGCTACTATATACACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTGGAAGTGGTAATACTAAGTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCCAGGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACAGCTTC............ACAAGCTACTATATACACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTGGA......AGTGGTAATACTAAGTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGC
IGHV-MQQF 12022-05-15watson_et_al:PWD_PhJ_IGHV1-32FPWD/PhJCAGGTTCAGCTGCAGCAGTCTGGGGCTGAGCTGGTGAGGCCTGGGTCCTCAGTGAAGATTTCCTGCAAGGCTTCTGGCTATGCATTCAGTAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGACAGGGTCTTGAGTGGATTGGACAGATTTATCCTGGAGATGGTGATACTAACTACAATGGAAAGTTCAAGGGTAAAGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTAACATCTGAGGACTCTGCGGTCTATTTCTGTGCCAGGTTCAGCTGCAGCAGTCTGGGGCT...GAGCTGGTGAGGCCTGGGTCCTCAGTGAAGATTTCCTGCAAGGCTTCTGGCTATGCATTC............AGTAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGACAGGGTCTTGAGTGGATTGGACAGATTTATCCTGGA......GATGGTGATACTAACTACAATGGAAAGTTCAAG...GGTAAAGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTAACATCTGAGGACTCTGCGGTCTATTTCTGTGC
IGHV-N64F 12022-05-15watson_et_al:PWD_PhJ_IGHV1-42FPWD/PhJCAGGTCCAACTGCAGCAGCCTGGGTCTGTGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACATTCACCAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGAGATTTATCCTAATAGTGGTAGAACTAACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGGATCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCCAGGTCCAACTGCAGCAGCCTGGGTCT...GTGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACATTC............ACCAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGAGATTTATCCTAAT......AGTGGTAGAACTAACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGGATCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGC
IGHV-NJKQ 12022-05-15IGHV5-15*01|Mus_musculus_C57BL/6watson_et_al:PWD_PhJ_IGHV5-6FPWD/PhJGAGGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTACGGAATGGCGTGGGTTCGACAGGCTCCAAGGAAGGGGCCTGAGTGGGTAGCATTCATTAGTAATTTGGCATATAGTATCTACTATGCAGACACTGTGACGGGCCGATTCACCATCTCTAGAGAGAATGCCAAGAACACCCTGTACCTGGAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGCAAGGAGGTGAAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTGACTACGGAATGGCGTGGGTTCGACAGGCTCCAAGGAAGGGGCCTGAGTGGGTAGCATTCATTAGTAATTTG......GCATATAGTATCTACTATGCAGACACTGTGACG...GGCCGATTCACCATCTCTAGAGAGAATGCCAAGAACACCCTGTACCTGGAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGCAAG
IGHV-NRA6 12022-05-15watson_et_al:PWD_PhJ_IGHV1-37FPWD/PhJCAGGTGCAACTGCAGCAGCCTGGGTCTGTGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACATTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGAGATTCATCCTAATAGTGGTAGTACTAACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACGTGGATCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAACAGGTGCAACTGCAGCAGCCTGGGTCT...GTGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACATTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGAGATTCATCCTAAT......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACGTGGATCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAA
IGHV-NROV 12022-05-15watson_et_al:PWD_PhJ_IGHV1-23FPWD/PhJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTAATCCTAATAGTGGTAGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTAATCCTAAT......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGT
IGHV-NVD7 12022-05-15watson_et_al:PWD_PhJ_IGHV9-1FPWD/PhJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAGAATATCCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTCAAGTGGATGGGCATGATATACACCGACACTGGAGAGCCAACATATGCTGATGACTTCAAGGGACGGTTTGCCTTTTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAATAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCAAGCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACAGAATATCCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTCAAGTGGATGGGCATGATATACACCGAC......ACTGGAGAGCCAACATATGCTGATGACTTCAAG...GGACGGTTTGCCTTTTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAATAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCAAG
IGHV-NVKX 12022-05-15watson_et_al:PWD_PhJ_IGHV1-29FPWD/PhJCAGGTCCAGCTGAAGCAGTCTGGACCTGAGCTGGTGAGGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACTTTCACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGCAAGGATTTATCCTGGAAGTGGTAATACTTACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGAAAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCTGTCTATTTCTGTGCACAGGTCCAGCTGAAGCAGTCTGGACCT...GAGCTGGTGAGGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACTTTC............ACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGCAAGGATTTATCCTGGA......AGTGGTAATACTTACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGAAAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCTGTCTATTTCTGTGCA
IGHV-O54O 12022-05-15watson_et_al:PWD_PhJ_IGHV8-4FPWD/PhJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTCTGGTATGGGTGTAGGCTGGATTCGTCAGCCATCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGGATGATGTCAAGCGCTATAACCCAGCCCTGAAGAGCCGACTGACTATCTCCAAGGATACCTCCAGCAGCCAGGTATTCCTCAAGATCGCCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCGACAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTCTGGTATGGGTGTAGGCTGGATTCGTCAGCCATCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGGAT.........GATGTCAAGCGCTATAACCCAGCCCTGAAG...AGCCGACTGACTATCTCCAAGGATACCTCCAGCAGCCAGGTATTCCTCAAGATCGCCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCGA
IGHV-OYF6 12022-05-15watson_et_al:PWD_PhJ_IGHV1-38FPWD/PhJCAGGTCCAACTGCAGCAGCCTGGGTCTGTGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGCGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGAGATTCATCCTAATAGTGGTAATATTAACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACGTGGATCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAGGTCCAACTGCAGCAGCCTGGGTCT...GTGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCACTGGGCGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGAGATTCATCCTAAT......AGTGGTAATATTAACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACGTGGATCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTG
IGHV-PTGV 12022-05-15watson_et_al:PWD_PhJ_IGHV1-31FPWD/PhJCAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAAGCTTCTGGCTACGCATTCAGTAGCTCCTGGATAAACTGGGTGAAGCAGAGGCCTGGAAAGGGTCTTGAGTGGATTGGACAGATTTATCCTGGAGATGGTGATACTAACTACAATGGAAAGTTCAAGGGTAAAGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTAACATCTGAGGACTCTGCAGTCTATTTCTGTGCCAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAAGCTTCTGGCTACGCATTC............AGTAGCTCCTGGATAAACTGGGTGAAGCAGAGGCCTGGAAAGGGTCTTGAGTGGATTGGACAGATTTATCCTGGA......GATGGTGATACTAACTACAATGGAAAGTTCAAG...GGTAAAGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTAACATCTGAGGACTCTGCAGTCTATTTCTGTGC
IGHV-PYRH 12022-05-15watson_et_al:PWD_PhJ_IGHV1-8FPWD/PhJGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGGGTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTGACTACAACATGCACTTGGTGAAGCAGAGCCATGGAAAGAGTCTTGAGTGGATTGGAGGTATTAATCCTAACAATGGTGCTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGGCTGACATCTGAGGATTCTGCAGTCTATTACTGTGCAAGAGAGGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGGTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACAACATGCACTTGGTGAAGCAGAGCCATGGAAAGAGTCTTGAGTGGATTGGAGGTATTAATCCTAAC......AATGGTGCTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGGCTGACATCTGAGGATTCTGCAGTCTATTACTGTGCAAGA
IGHV-QEOB 12022-05-15watson_et_al:PWD_PhJ_IGHV2-6FPWD/PhJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCGTCTCAGGGTTCTCATTAACTAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGTAGTGATATGGAGTGATGGAAGCACAACCTATAATTCAGCTCTCAAATCCAGACTGAGCATCAGCAAGGACAACGCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCACAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCGTCTCAGGGTTCTCATTA............ACTAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGTAGTGATATGGAGTGAT.........GGAAGCACAACCTATAATTCAGCTCTCAAA...TCCAGACTGAGCATCAGCAAGGACAACGCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCA
IGHV-QLQO 12022-05-15watson_et_al:PWD_PhJ_IGHV1-13FPWD/PhJGAAGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAAGCTTCTGGTTATTCTTTCACTGGCTACTACATAGACTGGGTGAAGCAGAGTCCTGGAAAGAGCCTTGAGTGGATTGGATATATTTATCCTTCCAATGGTGAAACCAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGTCAACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAGAAGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAAGCTTCTGGTTATTCTTTC............ACTGGCTACTACATAGACTGGGTGAAGCAGAGTCCTGGAAAGAGCCTTGAGTGGATTGGATATATTTATCCTTCC......AATGGTGAAACCAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGTCAACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCA
IGHV-QLUS 12022-05-15watson_et_al:PWD_PhJ_IGHV2-2FPWD/PhJCAGGTGCAGCTGAAGCAGTCAGGACCTGGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTAACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGTGGAAACACAGACTATAATGCAGCTTTCATATCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATACTACTGTGCCACAGGTGCAGCTGAAGCAGTCAGGACCT...GGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTA............ACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGT.........GGAAACACAGACTATAATGCAGCTTTCATA...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATACTACTGTGCCA
IGHV-QP6K 12022-05-15watson_et_al:PWD_PhJ_IGHV5-10FPWD/PhJGACGTGAAGCTCGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATTACATGTCTTGGGTTCGGCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAATACTGGTGGTAGCACCTACTATCCAGACACTGTGAAGGGGCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAATTCTGAGGACACAGCCGTGTATTACTGTGACGTGAAGCTCGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATTACATGTCTTGGGTTCGGCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAATACT......GGTGGTAGCACCTACTATCCAGACACTGTGAAG...GGGCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAATTCTGAGGACACAGCCGTGTATTACTGT
IGHV-R262 12022-05-15watson_et_al:PWD_PhJ_IGHV14-2FPWD/PhJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAGACACCTATATGCACTGGGTGAAGCAGAGGACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATATGCCCCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAGACACCTATATGCACTGGGTGAAGCAGAGGACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAG......GATGGTGAAACTAAATATGCCCCGAAGTTCCAG...GGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGT
IGHV-RN4F 12022-05-15watson_et_al:PWD_PhJ_IGHV1-19FPWD/PhJAAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTGAAACCCGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACTGAGTATATTATACACTGGGTAAAGCAGAGGTCTGGACAGGGTCTTGAGTGGATTGGGTGGTTTTACCCTGGAAGTGGTAGTATAAAGTACAATGAGAAATTCAAGGACAAGGCCACATTGACTGCGGACAAATCCTCCAGCACAGTCTATATGGAGCTTAGTAGATTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGACACGAAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTGAAACCCGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACTGAGTATATTATACACTGGGTAAAGCAGAGGTCTGGACAGGGTCTTGAGTGGATTGGGTGGTTTTACCCTGGA......AGTGGTAGTATAAAGTACAATGAGAAATTCAAG...GACAAGGCCACATTGACTGCGGACAAATCCTCCAGCACAGTCTATATGGAGCTTAGTAGATTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGACACG
IGHV-RXKT 12022-05-15watson_et_al:PWD_PhJ_IGHV5-5FPWD/PhJGAAGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTATTACATGTATTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAGTGGTGGTGGTAGCACCTATTATCCAGACACTGTAAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGCAAGAAGTGAAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTGACTATTACATGTATTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAGTGGT......GGTGGTAGCACCTATTATCCAGACACTGTAAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGCAA
IGHV-S2UL 12022-05-15watson_et_al:PWD_PhJ_IGHV1-17FPWD/PhJCAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTAAGGCCTGGGACTTCAGTGAAGGTGTCCTGCAAGGCTTCTGGATACGCCTTCACTAATTACTTGATAGAGTGGGTAAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAGTGATTAATCCTGGAAGTGGTGGTACTAACTACAATGAGAAGTTCAAGGGCAAGGCAACACTGACTGCAGACAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGATGACTCTGCGGTCTATTTCTGTGCAAGACAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTAAGGCCTGGGACTTCAGTGAAGGTGTCCTGCAAGGCTTCTGGATACGCCTTC............ACTAATTACTTGATAGAGTGGGTAAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAGTGATTAATCCTGGA......AGTGGTGGTACTAACTACAATGAGAAGTTCAAG...GGCAAGGCAACACTGACTGCAGACAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGATGACTCTGCGGTCTATTTCTGTGCAAGA
IGHV-SHLW 12022-05-15watson_et_al:PWD_PhJ_IGHV1-10FPWD/PhJGAGGTCCAGCTGCAACAATCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTCACTGACTACTACATGAAGTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGAAATTAATCCTAACAATGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGAGAGGTCCAGCTGCAACAATCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTC............ACTGACTACTACATGAAGTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGAAATTAATCCTAAC......AATGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGA
IGHV-SQWO 12022-05-15watson_et_al:PWD_PhJ_IGHV14-1FPWD/PhJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAGGCCAGGGACCTCAGTCAAGTTGTCCTGCAAAGCTTCTGGCTTCAACATTAAAGACTACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGAATGGTAATACTATATATGACCCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAGGCCAGGGACCTCAGTCAAGTTGTCCTGCAAAGCTTCTGGCTTCAACATT............AAAGACTACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAG......AATGGTAATACTATATATGACCCGAAGTTCCAG...GGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGT
IGHV-SVML 12022-05-15watson_et_al:PWD_PhJ_IGHV5-3FPWD/PhJGAAGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCGGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAACTATTACATGTATTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCATACATTAGTAGTAATGGTGGTAGCACCTATTATCCAGACACTGTAAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACGGCCATGTATTACTGTGCGAAGTGAAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCGGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAACTATTACATGTATTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCATACATTAGTAGTAAT......GGTGGTAGCACCTATTATCCAGACACTGTAAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACGGCCATGTATTACTGTGC
IGHV-TW2E 12022-05-15watson_et_al:PWD_PhJ_IGHV1-33FPWD/PhJGAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTAAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTGACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGAGATTTATCCTGGAAGTGGTAATACTTACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCAAGGAGGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTAAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGAGATTTATCCTGGA......AGTGGTAATACTTACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCAAG
IGHV-U7BS 12022-05-15watson_et_al:PWD_PhJ_IGHV5-2FPWD/PhJGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTTACATTCAGTAGCCATTTCATGGCATGGGTCCGCCAAACTCCAGAGAAAAGACTGGAGTGGGCCGCAAACATTTATCCTGATGGTGGTACCGCCTACTATCCAAACACTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAGGAATATCATGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGTAAGACAGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTTACATTC............AGTAGCCATTTCATGGCATGGGTCCGCCAAACTCCAGAGAAAAGACTGGAGTGGGCCGCAAACATTTATCCTGAT......GGTGGTACCGCCTACTATCCAAACACTGTGAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAGGAATATCATGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGTAAGACA
IGHV-UNUS 12022-05-15watson_et_al:PWD_PhJ_IGHV2-8FPWD/PhJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACTTGCACTGTCTCTGGGTTTTCATTAACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGCTGGTGGAAGCACAAATTATAATTCAGCTCTCATGTCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACTTGCACTGTCTCTGGGTTTTCATTA............ACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGCTGGT.........GGAAGCACAAATTATAATTCAGCTCTCATG...TCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCC
IGHV-UTKV 12022-05-15watson_et_al:PWD_PhJ_IGHV1-30FPWD/PhJCAGGTTCAGCTGCAACAGTCTGACGCTGAGTTGGTGAAACCTGGAGCTTCAGTGAAGATATCCTGCAAGGTTTCTGGCTACACCTTCACTGACCATACTATTCACTGGATGAAGCAGAGGCCTGAACAGGGCCTGGAATGGATTGGATATATTTATCCTAGAGATGGTAGTACTAAGTACAATGAGAAGTTCAAGGGCAAGGCCACATTGACTGCAGATAAATCCTCCAGCACTGCCTACATGCAGCTCAACAGCCTGACATCTGAGGATTCTGCAGTGTATTTCTGTGCAAGCAGGTTCAGCTGCAACAGTCTGACGCT...GAGTTGGTGAAACCTGGAGCTTCAGTGAAGATATCCTGCAAGGTTTCTGGCTACACCTTC............ACTGACCATACTATTCACTGGATGAAGCAGAGGCCTGAACAGGGCCTGGAATGGATTGGATATATTTATCCTAGA......GATGGTAGTACTAAGTACAATGAGAAGTTCAAG...GGCAAGGCCACATTGACTGCAGATAAATCCTCCAGCACTGCCTACATGCAGCTCAACAGCCTGACATCTGAGGATTCTGCAGTGTATTTCTGTGCAAG
IGHV-UXPY 12022-05-15watson_et_al:PWD_PhJ_IGHV5-14FPWD/PhJGAAGTGATGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGCCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTGGTGATGGTGGTAACACCTACTATCCAGACAGTGTGAAGGGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCTTGTATTACTGTGCAAGGAAGTGATGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATGCCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTGGTGAT......GGTGGTAACACCTACTATCCAGACAGTGTGAAG...GGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCTTGTATTACTGTGCAAG
IGHV-VPE2 12022-05-15watson_et_al:PWD_PhJ_IGHV1-4FPWD/PhJCAGGTTCAACTGCAGCAGTCTGGGGCTGAGCTGGTGAGGCCTGGGGCTTCAGTGACGCTGTCCTGCAAGGCTTCGGGCTACACATTTACTGACTATGAAATGCACTGGGTGAAGCAGACACCTGTGCACGGCCTGGAATGGATTGGAGCTATTCATCCAGGAAGTGGTGGTACTGCCTACAATCAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGACATCTGAGGACTCTGCCGTCTATTACTGTACAACAGGTTCAACTGCAGCAGTCTGGGGCT...GAGCTGGTGAGGCCTGGGGCTTCAGTGACGCTGTCCTGCAAGGCTTCGGGCTACACATTT............ACTGACTATGAAATGCACTGGGTGAAGCAGACACCTGTGCACGGCCTGGAATGGATTGGAGCTATTCATCCAGGA......AGTGGTGGTACTGCCTACAATCAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGACATCTGAGGACTCTGCCGTCTATTACTGTACAA
IGHV-VX3J 12022-05-15watson_et_al:PWD_PhJ_IGHV2-9FPWD/PhJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCGTCTCAGGGTTCTCATTAACCAGCTATGAAATAAACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGACTGGTGGAAGCACAAATTATAATTCAGCTCTCATATCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATATATTACTGTGTAAGACAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCGTCTCAGGGTTCTCATTA............ACCAGCTATGAAATAAACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGACTGGT.........GGAAGCACAAATTATAATTCAGCTCTCATA...TCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATATATTACTGTGTAAGA
IGHV-VYOV 12022-05-15IGHV5-16*01|Mus_musculus_C57BL/6watson_et_al:PWD_PhJ_IGHV5-7FPWD/PhJGAAGTGAAGCTGGTGGAGTCTGAGGGAGGCTTAGTGCAGCCTGGAAGTTCCATGAAACTCTCCTGCACAGCCTCTGGATTCACTTTCAGTGACTATTACATGGCTTGGGTCCGCCAGGTTCCAGAAAAGGGTCTAGAATGGGTTGCAAACATTAATTATGATGGTAGTAGCACCTACTATCTGGACTCCTTGAAGAGCCGTTTCATCATCTCGAGAGACAATGCAAAGAACATTCTATACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCACGTATTACTGTGCAAGAAGTGAAGCTGGTGGAGTCTGAGGGA...GGCTTAGTGCAGCCTGGAAGTTCCATGAAACTCTCCTGCACAGCCTCTGGATTCACTTTC............AGTGACTATTACATGGCTTGGGTCCGCCAGGTTCCAGAAAAGGGTCTAGAATGGGTTGCAAACATTAATTATGAT......GGTAGTAGCACCTACTATCTGGACTCCTTGAAG...AGCCGTTTCATCATCTCGAGAGACAATGCAAAGAACATTCTATACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCACGTATTACTGTGCAA
IGHV-WPS4 12022-05-15watson_et_al:PWD_PhJ_IGHV11-2FPWD/PhJGAAGTGCAGCTGTTGGAGACTGGAGGAGGCTTGGTGCAACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTTAGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGATGGCAGTGCAATAAACTACGCACCATCCATAAAGGATCGATTCACTATCTTCAGAGACAATGACAAAAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCTGAGGACACAGCCACGTATTTCTGTGAAGTGCAGCTGTTGGAGACTGGAGGA...GGCTTGGTGCAACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTT............AGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGAT......GGCAGTGCAATAAACTACGCACCATCCATAAAG...GATCGATTCACTATCTTCAGAGACAATGACAAAAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCTGAGGACACAGCCACGTATTTCTGT
IGHV-WR2L 12022-05-15IGHV14-4*01|Mus_musculus_C57BL/6watson_et_al:PWD_PhJ_IGHV14-4FPWD/PhJGAGGTTCAGCTGCAGCAGTCTGGGGCTGAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTTAACATTAAAGACGACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAGAATGGTGATACTGAATATGCCTCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGAGGTTCAGCTGCAGCAGTCTGGGGCT...GAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTTAACATT............AAAGACGACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAG......AATGGTGATACTGAATATGCCTCGAAGTTCCAG...GGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGT
IGHV-XFJ6 12022-05-15watson_et_al:PWD_PhJ_IGHV1-36FPWD/PhJCAGGTCCAACTGCAGCAGCCTGGGTCTGTGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACATTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGAGATTTATCCTAATAGTGGTAGGACTAACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACGTGGATCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAGGTCCAACTGCAGCAGCCTGGGTCT...GTGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACATTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGAGATTTATCCTAAT......AGTGGTAGGACTAACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACGTGGATCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTG
IGHV-XJRP 12022-05-15watson_et_al:PWD_PhJ_IGHV5-12FPWD/PhJGAAGTTAAGCTCGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGCCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAGCCATTAATAGTAATGGTGGTAGCACCTATTATCCAGACACTGTAAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTGCGAAGTTAAGCTCGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATGCCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAGCCATTAATAGTAAT......GGTGGTAGCACCTATTATCCAGACACTGTAAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTGC
IGHV-XRM4 12022-05-15watson_et_al:PWD_PhJ_IGHV1-12FPWD/PhJGAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGACTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTCACTGACTACAACATGGACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTTATCCTAACAATGGTGGTACTGGCTACAACCAGAAGTTCAAGAGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCTTACATGGAGCTCCACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCGAGGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGACTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACAACATGGACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTTATCCTAAC......AATGGTGGTACTGGCTACAACCAGAAGTTCAAG...AGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCTTACATGGAGCTCCACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGC
IGHV-XUAL 12022-05-15watson_et_al:PWD_PhJ_IGHV1-5FPWD/PhJGAGATCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTGACTACAACATGCAGTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGAAATTAATCCTTACAATGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGTCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCGAGATCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACAACATGCAGTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGAAATTAATCCTTAC......AATGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGTCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGC
IGHV-Y3TL 12022-05-15watson_et_al:PWD_PhJ_IGHV1-16FPWD/PhJGAGGTTCAGCTCCAGCAGTCTGGGACTGTGCTGGCAAGGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTTACCAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGCGCTATTTATCCTGGAAATAGTGATACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCAAACTGACTGCAGTCACATCTGCCAGCACTGCCTACATGGAGCTCAGCAGCCTGACAAATGAGGACTCTGCGGTCTATTACTGTGAGGTTCAGCTCCAGCAGTCTGGGACT...GTGCTGGCAAGGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTT............ACCAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGCGCTATTTATCCTGGA......AATAGTGATACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCAAACTGACTGCAGTCACATCTGCCAGCACTGCCTACATGGAGCTCAGCAGCCTGACAAATGAGGACTCTGCGGTCTATTACTGT
IGHV-YW25 12022-05-15watson_et_al:PWD_PhJ_IGHV14-3FPWD/PhJGAGGTTCAGCTGCAGCAGTCTGTGGCAGAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAAACACCTATATGCACTGGGTGAAGCAGAGGACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGCGAATGGTAATACTAAATATGCCCCGAAGTTCCAGGGCAAGGCCACTATAACTGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCATCTATTACTGTGGAGGTTCAGCTGCAGCAGTCTGTGGCA...GAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAAACACCTATATGCACTGGGTGAAGCAGAGGACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGCG......AATGGTAATACTAAATATGCCCCGAAGTTCCAG...GGCAAGGCCACTATAACTGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCATCTATTACTGTG
IGHV-ZKN6 12022-05-15watson_et_al:PWD_PhJ_IGHV2-3FPWD/PhJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCAGGGTTCTCATTAACCGGCTATGGTGTAAGCTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGAGTGATGGAAGCACAAACTATAATTCAGCTCTCAAATCCAGACTGAGCACCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCACAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCAGGGTTCTCATTA............ACCGGCTATGGTGTAAGCTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGAGTGAT.........GGAAGCACAAACTATAATTCAGCTCTCAAA...TCCAGACTGAGCACCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCA
IGHV-ZPB3 12022-05-15watson_et_al:PWD_PhJ_IGHV5-13FPWD/PhJGAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCTCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGGCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTGATGGTGGTAGTTACACCTACTATCCAGACAGTGTGAAGGGGCGATTCACCATCTCCAGAGACAATGACAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTGCAGAAGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCTCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATGGCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTGATGGT......GGTAGTTACACCTACTATCCAGACAGTGTGAAG...GGGCGATTCACCATCTCCAGAGACAATGACAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTGCA
IGHV-ZV4X 12022-05-15watson_et_al:PWD_PhJ_IGHV5-8FPWD/PhJGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCGGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTATGGAATGCACTGGGTTCGTCAGGCTCCAGAGAAGGGGCTGGAGTGGGTTGCATACATTAGTAGTGGCAGTAGTACCATCTACTATGCAGACACAGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTTCCTGCAAATGACCAGTCTAAGGTCTGAGGACACGGCCATGTATTACTGTGCAGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCGGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTGACTATGGAATGCACTGGGTTCGTCAGGCTCCAGAGAAGGGGCTGGAGTGGGTTGCATACATTAGTAGTGGC......AGTAGTACCATCTACTATGCAGACACAGTGAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTTCCTGCAAATGACCAGTCTAAGGTCTGAGGACACGGCCATGTATTACTGTGCA

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

History

History logs the times and reasons for the publication of each version of this germline set. Key changes are noted. For detailed changes, click on the link to the sequence.

William Lees
2022-05-15 16:21:23
Mouse germline set G00053 (PWD/PhJ IGH) created

Mouse germline set G00053 (PWD/PhJ IGH) created

William Lees
2022-05-15 16:25:36
Version 1 published

First release

Versions

All published versions of this germline set.

Set NameSpeciesSpecies subgroupLocusRelease VersionRelease Date
PWD/PhJ IGHMousePWD/PhJIGH12022-05-15