Notes

The germline set is based on sequences published in Watson et al. (2019)

Details

AuthorWilliam Lees
Lab Name
Lab AddressBirkbeck College, University of London, Malet Street, London
NameNOD/ShiLtJ IGH
SpeciesMouse
Species subgroupNOD/ShiLtJ
Subgroup typestrain
LocusIGH
Release Version1
Release DescriptionThe germline set is based on sequences published in Watson et al. (2019)
Release Date2022-05-15

Included Sequences

LabelVnDateIMGT NameAlt NamesFunctionalitySubgrpSequenceGapped Sequence
IGHD-DJ7I 12022-05-15IGHD1-1*01|Mus_musculus_BALB/cwatson_et_al:NOD_ShiLtJ_IGHD1-1*01FNOD/ShiLtJTTTATTACTACGGTAGTAGCTACTTTATTACTACGGTAGTAGCTAC
IGHD-FLR4 12022-05-15IGHD2-5*01|Mus_musculus_CB.20,IGHD2-6*01|Mus_musculus_C57BL/6Jwatson_et_al:NOD_ShiLtJ_IGHD2-5*01|IGHD2-6*01FNOD/ShiLtJCCTACTATAGTAACTACCCTACTATAGTAACTAC
IGHD-LQ3V 12022-05-15IGHD2-1*01|Mus_musculus_129/Sv,IGHD2-8*01|Mus_musculus_BALB/cwatson_et_al:NOD_ShiLtJ_IGHD2-1*01|IGHD2-8*01FNOD/ShiLtJTCTACTATGGTAACTACTCTACTATGGTAACTAC
IGHD-QCGS 12022-05-15IGHD2-2*01|Mus_musculus_BALB/c,IGHD2-7*01|Mus_musculus_BALB/cwatson_et_al:NOD_ShiLtJ_IGHD2-2*01|IGHD2-7*01FNOD/ShiLtJTCTACTATGGTTACGACTCTACTATGGTTACGAC
IGHD-RZIX 12022-05-15IGHD2-4*01|Mus_musculus_BALB/c,IGHD2-9*02|Mus_musculus_129/Svwatson_et_al:NOD_ShiLtJ_IGHD2-4*01|IGHD2-9*02FNOD/ShiLtJTCTACTATGATTACGACTCTACTATGATTACGAC
IGHD-TZK7 12022-05-15IGHD4-1*02|Mus_musculus_BALB/cwatson_et_al:NOD_ShiLtJ_IGHD4-1*02FNOD/ShiLtJCAACTGGGACCAACTGGGAC
IGHD-VJXU 12022-05-15IGHD4-1*01|Mus_musculus_BALB/cwatson_et_al:NOD_ShiLtJ_IGHD4-1*01FNOD/ShiLtJCTAACTGGGACCTAACTGGGAC
IGHD-WGD3 12022-05-15IGHD3-2*02|Mus_musculus_C57BL/6Jwatson_et_al:NOD_ShiLtJ_IGHD3-2*02FNOD/ShiLtJAGACAGCTCAGGCTACAGACAGCTCAGGCTAC
IGHD-YYV5 12022-05-15IGHD2-3*01|Mus_musculus_BALB/cwatson_et_al:NOD_ShiLtJ_IGHD2-3*01FNOD/ShiLtJTCTATGATGGTTACTACTCTATGATGGTTACTAC
IGHJ-NMIK 12022-05-15IGHJ1*03|Mus_musculus_A/Jwatson_et_al:NOD_ShiLtJ_IGHJ1*03FNOD/ShiLtJCTACTGGTACTTCGATGTCTGGGGCACAGGGACCACGGTCACCGTCTCCTCAGCTACTGGTACTTCGATGTCTGGGGCACAGGGACCACGGTCACCGTCTCCTCAG
IGHJ-PYGL 12022-05-15IGHJ4*01|Mus_musculuswatson_et_al:NOD_ShiLtJ_IGHJ4*01FNOD/ShiLtJATTACTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGATTACTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAG
IGHJ-V42E 12022-05-15IGHJ3*01|Mus_musculuswatson_et_al:NOD_ShiLtJ_IGHJ3*01FNOD/ShiLtJCCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAGCCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAG
IGHJ-VGTM 12022-05-15IGHJ2*01|Mus_musculuswatson_et_al:NOD_ShiLtJ_IGHJ2*02FNOD/ShiLtJACTACTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAGACTACTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAG
IGHV-2L5T 12022-05-15IGHV1-78*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-36FNOD/ShiLtJCAGGTTCAGCTGCAACAGTCTGACGCTGAGTTGGTGAAACCTGGAGCTTCAGTGAAGATATCCTGCAAGGTTTCTGGCTACACCTTCACTGACCATACTATTCACTGGATGAAGCAGAGGCCTGAACAGGGCCTGGAATGGATTGGATATATTTATCCTAGAGATGGTAGTACTAAGTACAATGAGAAGTTCAAGGGCAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTCAGGTTCAGCTGCAACAGTCTGACGCT...GAGTTGGTGAAACCTGGAGCTTCAGTGAAGATATCCTGCAAGGTTTCTGGCTACACCTTC............ACTGACCATACTATTCACTGGATGAAGCAGAGGCCTGAACAGGGCCTGGAATGGATTGGATATATTTATCCTAGA......GATGGTAGTACTAAGTACAATGAGAAGTTCAAG...GGCAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGT
IGHV-2RKB 12022-05-15IGHV7-4*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV7-3FNOD/ShiLtJGAGGTGAAGCTGATGGAATCTGGAGGAGGCTTGGTACAGCCTGGGGCTTCTCTGAGACTCTCCTGTGCAGCTTCTGGATTCACCTTTACTGATTACTACATGAGCTGGGTCCGCCAGCCTCCAGGGAAGGCACCTGAGTGGTTGGCTTTGATTAGAAACAAAGCTAATGGTTACACAACAGAGTATACTGCATCTGTTAAGGGTCGGTTCACCATCTCCAGAGATAATTCCCAAAACATCCTCTATCTTCAAATGAACACCCTGAGGGCTGAGGACAGTGCCACTTATTACTGTGTAAAAGGAGGTGAAGCTGATGGAATCTGGAGGA...GGCTTGGTACAGCCTGGGGCTTCTCTGAGACTCTCCTGTGCAGCTTCTGGATTCACCTTT............ACTGATTACTACATGAGCTGGGTCCGCCAGCCTCCAGGGAAGGCACCTGAGTGGTTGGCTTTGATTAGAAACAAAGCTAATGGTTACACAACAGAGTATACTGCATCTGTTAAG...GGTCGGTTCACCATCTCCAGAGATAATTCCCAAAACATCCTCTATCTTCAAATGAACACCCTGAGGGCTGAGGACAGTGCCACTTATTACTGTGTAAAAG
IGHV-2SWB 12022-05-15IGHV2-5*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV2-4FNOD/ShiLtJCAGGTGCAGCTGAAGCAGTCAGGACCTGGCCTAGTGCAGCCCTCACAGAGCCTGTCCATAACCTGCACAGTCTCTGGTTTCTCATTAACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGAGGTGGAAGCACAGACTACAATGCAGCTTTCATGTCCAGACTGAGCATCACCAAGGACAACTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACTGCCATATACTACTGTGCCCAGGTGCAGCTGAAGCAGTCAGGACCT...GGCCTAGTGCAGCCCTCACAGAGCCTGTCCATAACCTGCACAGTCTCTGGTTTCTCATTA............ACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGAGGT.........GGAAGCACAGACTACAATGCAGCTTTCATG...TCCAGACTGAGCATCACCAAGGACAACTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACTGCCATATACTACTGTGCC
IGHV-3DJB 12022-05-15IGHV9-4*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV9-4FNOD/ShiLtJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAACTGCTGGAATGCAGTGGGTGCAAAAGATGCCAGGAAAGGGTTTTAAGTGGATTGGCTGGATAAACACCCACTCTGGAGAGCCAAAATATGCAGAAGACTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTACAGATAAGCAACCTCAAAAATGAGGACACGGCTACGTATTTCTGTGCGCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACAACTGCTGGAATGCAGTGGGTGCAAAAGATGCCAGGAAAGGGTTTTAAGTGGATTGGCTGGATAAACACCCAC......TCTGGAGAGCCAAAATATGCAGAAGACTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTACAGATAAGCAACCTCAAAAATGAGGACACGGCTACGTATTTCTGTGCG
IGHV-3TUX 12022-05-15watson_et_al:NOD_ShiLtJ_IGHV1-29FNOD/ShiLtJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGATGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATCGGAGAGATTGATCCTTCTGATAGTTATACTAACTACAATCAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTTGTGATGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATCGGAGAGATTGATCCTTCT......GATAGTTATACTAACTACAATCAAAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGC
IGHV-42PJ 12022-05-15IGHV1-52*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-18FNOD/ShiLtJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTGGTGAGGCCTGGGTCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCATTGGGTGAAGCAGAGGCCTATACAAGGCCTTGAATGGATTGGTAACATTGACCCTTCTGATAGTGAAACTCACTACAATCAAAAGTTCAAGGACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAAGCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTGGTGAGGCCTGGGTCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCATTGGGTGAAGCAGAGGCCTATACAAGGCCTTGAATGGATTGGTAACATTGACCCTTCT......GATAGTGAAACTCACTACAATCAAAAGTTCAAG...GACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAAG
IGHV-44A6 12022-05-15IGHV1-72*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-31FNOD/ShiLtJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAATAGTGGTGGTACTAAGTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAAT......AGTGGTGGTACTAAGTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACAAACCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGT
IGHV-4FMN 12022-05-15IGHV2-6*01|Mus_musculus_C57BL/6,IGHV2-6-8*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV2-5FNOD/ShiLtJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCTGGGTTCTCATTAACCAGCTATGGTGTAGACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGTTGGAAGCACAAATTATAATTCAGCTCTCAAATCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCACAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCTGGGTTCTCATTA............ACCAGCTATGGTGTAGACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGTT.........GGAAGCACAAATTATAATTCAGCTCTCAAA...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCA
IGHV-4XGB 12022-05-15IGHV1-55*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-21FNOD/ShiLtJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATAACCTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGATATTTATCCTGGTAGTGGTAGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATAACCTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGATATTTATCCTGGT......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTG
IGHV-56TM 12022-05-15IGHV14-2*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV14-2FNOD/ShiLtJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAGACTACTATATGCACTGGGTGAAGCAGAGGACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGAAACTAAATATGCCCCGAAATTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAGACTACTATATGCACTGGGTGAAGCAGAGGACTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAG......GATGGTGAAACTAAATATGCCCCGAAATTCCAG...GGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGT
IGHV-5S7P 12022-05-15IGHV7-1*01|Mus_musculus_C57BL/6,IGHV7-1*03|Mus_musculus_C57BL/10watson_et_al:NOD_ShiLtJ_IGHV7-1FNOD/ShiLtJGAGGTGAAGCTGGTGGAATCTGGAGGAGGCTTGGTACAGTCTGGGCGTTCTCTGAGACTCTCCTGTGCAACTTCTGGGTTCACCTTCAGTGATTTCTACATGGAGTGGGTCCGCCAAGCTCCAGGGAAGGGACTGGAGTGGATTGCTGCAAGTAGAAACAAAGCTAATGATTATACAACAGAGTACAGTGCATCTGTGAAGGGTCGGTTCATCGTCTCCAGAGACACTTCCCAAAGCATCCTCTACCTTCAGATGAATGCCCTGAGAGCTGAGGACACTGCCATTTATTACTGTGCAAGAGGAGGTGAAGCTGGTGGAATCTGGAGGA...GGCTTGGTACAGTCTGGGCGTTCTCTGAGACTCTCCTGTGCAACTTCTGGGTTCACCTTC............AGTGATTTCTACATGGAGTGGGTCCGCCAAGCTCCAGGGAAGGGACTGGAGTGGATTGCTGCAAGTAGAAACAAAGCTAATGATTATACAACAGAGTACAGTGCATCTGTGAAG...GGTCGGTTCATCGTCTCCAGAGACACTTCCCAAAGCATCCTCTACCTTCAGATGAATGCCCTGAGAGCTGAGGACACTGCCATTTATTACTGTGCAAGAG
IGHV-6OM7 12022-05-15IGHV7-3*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV7-2FNOD/ShiLtJGAGGTGAAGCTGGTGGAGTCTGGAGGAGGCTTGGTACAGCCTGGGGGTTCTCTGAGTCTCTCCTGTGCAGCTTCTGGATTCACCTTCACTGATTACTACATGAGCTGGGTCCGCCAGCCTCCAGGGAAGGCACTTGAGTGGTTGGGTTTTATTAGAAACAAAGCTAATGGTTACACAACAGAGTACAGTGCATCTGTGAAGGGTCGGTTCACCATCTCCAGAGATAATTCCCAAAGCATCCTCTATCTTCAAATGAATGCCCTGAGAGCTGAGGACAGTGCCACTTATTACTGTGCAGAGGTGAAGCTGGTGGAGTCTGGAGGA...GGCTTGGTACAGCCTGGGGGTTCTCTGAGTCTCTCCTGTGCAGCTTCTGGATTCACCTTC............ACTGATTACTACATGAGCTGGGTCCGCCAGCCTCCAGGGAAGGCACTTGAGTGGTTGGGTTTTATTAGAAACAAAGCTAATGGTTACACAACAGAGTACAGTGCATCTGTGAAG...GGTCGGTTCACCATCTCCAGAGATAATTCCCAAAGCATCCTCTATCTTCAAATGAATGCCCTGAGAGCTGAGGACAGTGCCACTTATTACTGTGCA
IGHV-72ON 12022-05-15IGHV1-37*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-12FNOD/ShiLtJGAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTTACTGGCTACTTTATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACGTATTAATCCTTACAATGGTGATACTTTCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCTAGCACAGCCCACATGGAGCTCCTGAGCCTGACATCTGAGGACTTTGCAGTCTATTATTGTGCAAGAGAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTT............ACTGGCTACTTTATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACGTATTAATCCTTAC......AATGGTGATACTTTCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCTAGCACAGCCCACATGGAGCTCCTGAGCCTGACATCTGAGGACTTTGCAGTCTATTATTGTGCAAGA
IGHV-7BXK 12022-05-15IGHV1-9*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-41FNOD/ShiLtJCAGGTTCAGCTGCAGCAGTCTGGAGCTGAGCTGATGAAGCCTGGGGCCTCAGTGAAGCTTTCCTGCAAGGCTACTGGCTACACATTCACTGGCTACTGGATAGAGTGGGTAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGAGATTTTACCTGGAAGTGGTAGTACTAACTACAATGAGAAGTTCAAGGGCAAGGCCACATTCACTGCAGATACATCCTCCAACACAGCCTACATGCAACTCAGCAGCCTGACAACTGAGGACTCTGCCATCTATTACTGTGCCAGGTTCAGCTGCAGCAGTCTGGAGCT...GAGCTGATGAAGCCTGGGGCCTCAGTGAAGCTTTCCTGCAAGGCTACTGGCTACACATTC............ACTGGCTACTGGATAGAGTGGGTAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGAGATTTTACCTGGA......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...GGCAAGGCCACATTCACTGCAGATACATCCTCCAACACAGCCTACATGCAACTCAGCAGCCTGACAACTGAGGACTCTGCCATCTATTACTGTGC
IGHV-7KFN 12022-05-15IGHV5-12*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV5-1FNOD/ShiLtJGAAGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTATTACATGTATTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCATACATTAGTAATGGTGGTGGTAGCACCTATTATCCAGACACTGTAAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCCGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTGCAAGAAGTGAAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTGACTATTACATGTATTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCATACATTAGTAATGGT......GGTGGTAGCACCTATTATCCAGACACTGTAAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCCGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTGCAA
IGHV-ACRC 12022-05-15IGHV9-1*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV9-1FNOD/ShiLtJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAGAATATCCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTCAAGTGGATGGGCATGATATACACCGACACTGGAGAGCCAACATATGCTGAAGAGTTCAAGGGACGGTTTGCCTTCTCTTTGGAGACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACAGAATATCCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTCAAGTGGATGGGCATGATATACACCGAC......ACTGGAGAGCCAACATATGCTGAAGAGTTCAAG...GGACGGTTTGCCTTCTCTTTGGAGACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGT
IGHV-ATR7 12022-05-15IGHV5-6*01|Mus_musculus_C57BL/6,IGHV5-6-1*01|Mus_musculus_129/Svwatson_et_al:NOD_ShiLtJ_IGHV5-7FNOD/ShiLtJGAGGTGCAGCTGGTGGAGTCTGGGGGAGACTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGGCATGTCTTGGGTTCGCCAGACTCCAGACAAGAGGCTGGAGTGGGTCGCAACCATTAGTAGTGGTGGTAGTTACACCTACTATCCAGACAGTGTGAAGGGGCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTGCAGAGGTGCAGCTGGTGGAGTCTGGGGGA...GACTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATGGCATGTCTTGGGTTCGCCAGACTCCAGACAAGAGGCTGGAGTGGGTCGCAACCATTAGTAGTGGT......GGTAGTTACACCTACTATCCAGACAGTGTGAAG...GGGCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTGCA
IGHV-BBJT 12022-05-15IGHV2-6*03|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV2-6FNOD/ShiLtJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCGTCTCAGGGTTCTCATTAACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGTAGTGATATGGAGTGATGGAAGCACAACCTATAATTCAGCTCTCAAATCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTCCAAACTGATGACACAGCCATGTACTACTGTGCCCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCGTCTCAGGGTTCTCATTA............ACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGTAGTGATATGGAGTGAT.........GGAAGCACAACCTATAATTCAGCTCTCAAA...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTCCAAACTGATGACACAGCCATGTACTACTGTGCC
IGHV-BCRK 12022-05-15IGHV6-3*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV6-1FNOD/ShiLtJGAAGTGAAGCTTGAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTTGCCTCTGGATTCACTTTCAGTAACTACTGGATGAACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTCAAATTAGATTGAAATCTGATAATTATGCAACACATTATGCGGAGTCTGTGAAAGGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGGGCTGAAGACACTGGAATTTATTACTGCGAAGTGAAGCTTGAGGAGTCTGGAGGA...GGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTTGCCTCTGGATTCACTTTC............AGTAACTACTGGATGAACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTCAAATTAGATTGAAATCTGATAATTATGCAACACATTATGCGGAGTCTGTGAAA...GGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGGGCTGAAGACACTGGAATTTATTACTGC
IGHV-BFS3 12022-05-15IGHV10-3*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV10-2FNOD/ShiLtJGAGGTGCAGCTTGTTGAGTCTGGTGGAGGATTGGTGCAGCCTAAAGGATCATTGAAACTCTCATGTGCCGCCTCTGGTTTCACCTTCAATACCTATGCCATGCACTGGGTCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTAGTAATTATGCAACATATTATGCCGATTCAGTGAAAGACAGATTCACCATCTCCAGAGATGATTCACAAAGCATGCTCTATCTGCAAATGAACAACCTGAAAACTGAGGACACAGCCATGTATTACTGTGTGAGGTGCAGCTTGTTGAGTCTGGTGGA...GGATTGGTGCAGCCTAAAGGATCATTGAAACTCTCATGTGCCGCCTCTGGTTTCACCTTC............AATACCTATGCCATGCACTGGGTCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTAGTAATTATGCAACATATTATGCCGATTCAGTGAAA...GACAGATTCACCATCTCCAGAGATGATTCACAAAGCATGCTCTATCTGCAAATGAACAACCTGAAAACTGAGGACACAGCCATGTATTACTGTGT
IGHV-BHDA 12022-05-15IGHV1-61*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-24FNOD/ShiLtJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTGGTGAGGCCTGGGTCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGGATTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAATGGATTGGTAACATTTACCCTTCTGATAGTGAAACTCACTACAATCAAAAGTTCAAGGACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAACAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTGGTGAGGCCTGGGTCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGGATTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAATGGATTGGTAACATTTACCCTTCT......GATAGTGAAACTCACTACAATCAAAAGTTCAAG...GACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAA
IGHV-BO57 12022-05-15IGHV1-26*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-8FNOD/ShiLtJGAGGTCCAGCTGCAACAATCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGTAAGGCTTCTGGATACACGTTCACTGACTACTACATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAACAATGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGAGGTCCAGCTGCAACAATCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGTAAGGCTTCTGGATACACGTTC............ACTGACTACTACATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAAC......AATGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGT
IGHV-BSFJ 12022-05-15IGHV12-3*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV12-1FNOD/ShiLtJCAGATGCAGCTTCAGGAGTCAGGACCTGGCCTGGTGAAACCCTCACAGTCACTCTTCCTTACCTGCTCTATTACTGGTTTCCCCATCACCAGTGGTTACTACTGGATCTGGATCCGTCAGTCACCTGGGAAACCCCTAGAATGGATGGGGTACATCACTCATAGTGGGGAAACTTTCTACAACCCATCTCTCCAGAGCCCCATCTCCATTACTAGAGAAACGTCAAAGAACCAGTTCTTCCTCCAATTGAACTCTGTGACCACAGAGGACACAGCCATGTATTACTGTGCAGGCAGATGCAGCTTCAGGAGTCAGGACCT...GGCCTGGTGAAACCCTCACAGTCACTCTTCCTTACCTGCTCTATTACTGGTTTCCCCATCACC.........AGTGGTTACTACTGGATCTGGATCCGTCAGTCACCTGGGAAACCCCTAGAATGGATGGGGTACATCACTCATAGT.........GGGGAAACTTTCTACAACCCATCTCTCCAG...AGCCCCATCTCCATTACTAGAGAAACGTCAAAGAACCAGTTCTTCCTCCAATTGAACTCTGTGACCACAGAGGACACAGCCATGTATTACTGTGCAGG
IGHV-BWAR 12022-05-15IGHV14-3*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV14-3FNOD/ShiLtJGAGGTTCAGCTGCAGCAGTCTGTGGCAGAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAAACACCTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGCGAATGGTAATACTAAATATGCCCCGAAGTTCCAGGGCAAGGCCACTATAACTGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCATCTATTACTGTGAGGTTCAGCTGCAGCAGTCTGTGGCA...GAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAAACACCTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGCG......AATGGTAATACTAAATATGCCCCGAAGTTCCAG...GGCAAGGCCACTATAACTGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCATCTATTACTGT
IGHV-CMND 12022-05-15IGHV1-64*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-27FNOD/ShiLtJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTGGTAAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACTTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAATGATTCATCCTAATAGTGGTAGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTGGTAAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACTTTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAATGATTCATCCTAAT......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTG
IGHV-CPHS 12022-05-15IGHV1-82*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-39FNOD/ShiLtJCAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAGGCTTCTGGCTACGCATTCAGTAGCTCCTGGATGAACTGGGTGAAGCAGAGGCCTGGAAAGGGTCTTGAGTGGATTGGACGGATTTATCCTGGAGATGGAGATACTAACTACAATGGGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTACTTCTGTCAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAGGCTTCTGGCTACGCATTC............AGTAGCTCCTGGATGAACTGGGTGAAGCAGAGGCCTGGAAAGGGTCTTGAGTGGATTGGACGGATTTATCCTGGA......GATGGAGATACTAACTACAATGGGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTACTTCTGT
IGHV-DFGG 12022-05-15IGHV2-9*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV2-8FNOD/ShiLtJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACTTGCACTGTCTCTGGGTTTTCATTAACCAGCTATGGTGTAGACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGGTGGAAGCACAAATTATAATTCAGCTCTCATGTCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACTTGCACTGTCTCTGGGTTTTCATTA............ACCAGCTATGGTGTAGACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGGT.........GGAAGCACAAATTATAATTCAGCTCTCATG...TCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGC
IGHV-DSEM 12022-05-15IGHV1-63*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-26FNOD/ShiLtJCAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTAAGGCCTGGGACTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACCTTCACTAACTACTGGATAGGTTGGGCAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGATATTTACCCTGGAGGTGGTTATACTAACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGTTCAGCAGCCTGACATCTGAGGACTCTGCCATCTATTACTGTGCCAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTAAGGCCTGGGACTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACCTTC............ACTAACTACTGGATAGGTTGGGCAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGAGATATTTACCCTGGA......GGTGGTTATACTAACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGTTCAGCAGCCTGACATCTGAGGACTCTGCCATCTATTACTGTGC
IGHV-DVUJ 12022-05-15IGHV1-39*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-13FNOD/ShiLtJGAGTTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGCGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGACTACAACATGAACTGGGTGAAGCAGAGCAATGGAAAGAGCCTTGAGTGGATTGGAGTAATTAATCCTAACTATGGTACTACTAGCTACAATCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACCAATCTTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCGAGTTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGCGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTC............ACTGACTACAACATGAACTGGGTGAAGCAGAGCAATGGAAAGAGCCTTGAGTGGATTGGAGTAATTAATCCTAAC......TATGGTACTACTAGCTACAATCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACCAATCTTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGC
IGHV-E4PT 12022-05-15IGHV1-76*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-34FNOD/ShiLtJCAGGTCCAGCTGAAGCAGTCTGGGGCTGAGCTGGTGAGGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACTTTCACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGCAAGGATTTATCCTGGAAGTGGTAATACTTACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGAAAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCTGTCTATTTCTGTCAGGTCCAGCTGAAGCAGTCTGGGGCT...GAGCTGGTGAGGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACTTTC............ACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGCAAGGATTTATCCTGGA......AGTGGTAATACTTACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGAAAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCTGTCTATTTCTGT
IGHV-EBSY 12022-05-15IGHV1-20*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-6FNOD/ShiLtJGAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGATTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTTACTGGCTACTTTATGAACTGGGTGATGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACGTATTAATCCTTACAATGGTGATACTTTCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCTAGCACAGCCCACATGGAGCTCCGGAGCCTGACATCTGAGGACTCTGCAGTCTATTATTGTGCAAGGAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGATTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTT............ACTGGCTACTTTATGAACTGGGTGATGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACGTATTAATCCTTAC......AATGGTGATACTTTCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCTAGCACAGCCCACATGGAGCTCCGGAGCCTGACATCTGAGGACTCTGCAGTCTATTATTGTGCAAG
IGHV-F5CV 12022-05-15IGHV1-36*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-11FNOD/ShiLtJGAGGTCCAGCTGCAACAGTCTGGACCTGTGCTGGTGAAGCCTGGGCCTTCAGTGAAGATATCCTGTAAGGCTTCTGGATTCACATTCACTGACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACTTGTTTATCCTTACAATGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCCTACATGGAGCTAAACAGCCTGACTTCTGAGGACTCTGCGGTCTATTACTGTGCAGAGGTCCAGCTGCAACAGTCTGGACCT...GTGCTGGTGAAGCCTGGGCCTTCAGTGAAGATATCCTGTAAGGCTTCTGGATTCACATTC............ACTGACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACTTGTTTATCCTTAC......AATGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCCTACATGGAGCTAAACAGCCTGACTTCTGAGGACTCTGCGGTCTATTACTGTGCA
IGHV-FBNY 12022-05-15IGHV2-9-1*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV2-7FNOD/ShiLtJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCTGGGTTCTCATTAACCAGCTATGCTATAAGCTGGGTTCGCCAGCCACCAGGAAAGGGTCTGGAGTGGCTTGGAGTAATATGGACTGGTGGAGGCACAAATTATAATTCAGCTCTCAAATCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGTCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCAGGTACTACTGTGCCACAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCTGGGTTCTCATTA............ACCAGCTATGCTATAAGCTGGGTTCGCCAGCCACCAGGAAAGGGTCTGGAGTGGCTTGGAGTAATATGGACTGGT.........GGAGGCACAAATTATAATTCAGCTCTCAAA...TCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGTCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCAGGTACTACTGTGCCA
IGHV-FNXX 12022-05-15IGHV14-4*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV14-4FNOD/ShiLtJGAGGTTCAGCTGCAGCAGTCTGGGGCTGAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTTAACATTAAAGACGACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAGAATGGTGATACTGAATATGCCTCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTACTGAGGTTCAGCTGCAGCAGTCTGGGGCT...GAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTTAACATT............AAAGACGACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAG......AATGGTGATACTGAATATGCCTCGAAGTTCCAG...GGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTACT
IGHV-FROE 12022-05-15IGHV1-18*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-4FNOD/ShiLtJGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATACCCTGCAAGGCTTCTGGATACACATTCACTGACTACAACATGGACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAACAATGGTGGTACTATCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACACTGCAGTCTATTACTGTGCAGAGGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATACCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACAACATGGACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAAC......AATGGTGGTACTATCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACACTGCAGTCTATTACTGTGCA
IGHV-FTGA 12022-05-15IGHV10-1*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV10-1FNOD/ShiLtJGAGGTGCAGCTTGTTGAGTCTGGTGGAGGATTGGTGCAGCCTAAAGGGTCATTGAAACTCTCATGTGCAGCCTCTGGATTCAGCTTCAATACCTACGCCATGAACTGGGTCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTAATAATTATGCAACATATTATGCCGATTCAGTGAAAGACAGATTCACCATCTCCAGAGATGATTCAGAAAGCATGCTCTATCTGCAAATGAACAACTTGAAAACTGAGGACACAGCCATGTATTACTGTGTGAGGTGCAGCTTGTTGAGTCTGGTGGA...GGATTGGTGCAGCCTAAAGGGTCATTGAAACTCTCATGTGCAGCCTCTGGATTCAGCTTC............AATACCTACGCCATGAACTGGGTCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTAATAATTATGCAACATATTATGCCGATTCAGTGAAA...GACAGATTCACCATCTCCAGAGATGATTCAGAAAGCATGCTCTATCTGCAAATGAACAACTTGAAAACTGAGGACACAGCCATGTATTACTGTGT
IGHV-FTLS 12022-05-15IGHV5-16*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV5-3FNOD/ShiLtJGAAGTGAAGCTGGTGGAGTCTGAGGGAGGCTTAGTGCAGCCTGGAAGTTCCATGAAACTCTCCTGCACAGCCTCTGGATTCACTTTCAGTGACTATTACATGGCTTGGGTCCGCCAGGTTCCAGAAAAGGGTCTAGAATGGGTTGCAAACATTAATTATGATGGTAGTAGCACCTACTATCTGGACTCCTTGAAGAGCCGTTTCATCATCTCGAGAGACAATGCAAAGAACATTCTATACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCACGTATTACTGTGCAAGAAGTGAAGCTGGTGGAGTCTGAGGGA...GGCTTAGTGCAGCCTGGAAGTTCCATGAAACTCTCCTGCACAGCCTCTGGATTCACTTTC............AGTGACTATTACATGGCTTGGGTCCGCCAGGTTCCAGAAAAGGGTCTAGAATGGGTTGCAAACATTAATTATGAT......GGTAGTAGCACCTACTATCTGGACTCCTTGAAG...AGCCGTTTCATCATCTCGAGAGACAATGCAAAGAACATTCTATACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCACGTATTACTGTGCAA
IGHV-GNJT 12022-05-15IGHV1-80*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-37FNOD/ShiLtJCAGGTTCAGCTGCAGCAGTCTGGGGCTGAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAAGCTTCTGGCTACGCATTCAGTAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGAAAGGGTCTTGAGTGGATTGGACAGATTTATCCTGGAGATGGTGATACTAACTACAACGGAAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTTCTGTGCACAGGTTCAGCTGCAGCAGTCTGGGGCT...GAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAAGCTTCTGGCTACGCATTC............AGTAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGAAAGGGTCTTGAGTGGATTGGACAGATTTATCCTGGA......GATGGTGATACTAACTACAACGGAAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTTCTGTGCA
IGHV-GRQT 12022-05-15IGHV8-8*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV8-4FNOD/ShiLtJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTTTGGTATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGGATGATGATAAGTACTATAACCCAGCCCTGAAGAGTCGGCTCACAATCTCCAAGGATACCTCCAAAAACCAGGTATTCCTCAAGATCGCCAATGTGGACACTGCAGATACTGCCACATACTACTGTGCTCGCAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTTTGGTATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGGAT.........GATGATAAGTACTATAACCCAGCCCTGAAG...AGTCGGCTCACAATCTCCAAGGATACCTCCAAAAACCAGGTATTCCTCAAGATCGCCAATGTGGACACTGCAGATACTGCCACATACTACTGTGCTCG
IGHV-GVKR 12022-05-15IGHV1-15*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-3FNOD/ShiLtJCAGGTTCAACTGCAGCAGTCTGGGGCTGAGCTGGTGAGGCCTGGGGCTTCAGTGACGCTGTCCTGCAAGGCTTCGGGCTACACATTTACTGACTATGAAATGCACTGGGTGAAGCAGACACCTGTGCATGGCCTGGAATGGATTGGAGCTATTGATCCTGAAACTGGTGGTACTGCCTACAATCAGAAGTTCAAGGGCAAGGCCATACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCCGTCTATTACTGTCAGGTTCAACTGCAGCAGTCTGGGGCT...GAGCTGGTGAGGCCTGGGGCTTCAGTGACGCTGTCCTGCAAGGCTTCGGGCTACACATTT............ACTGACTATGAAATGCACTGGGTGAAGCAGACACCTGTGCATGGCCTGGAATGGATTGGAGCTATTGATCCTGAA......ACTGGTGGTACTGCCTACAATCAGAAGTTCAAG...GGCAAGGCCATACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCCGTCTATTACTGT
IGHV-HGHG 12022-05-15IGHV1-75*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-33FNOD/ShiLtJCAGGTCCAGCTACAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACCTTCACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTTTCCTGGAAGTGGTAGTACTTACTACAATGAGAAGTTCAAGGGCAAGGCCACACTTACTGTAGACAAATCCTCCAGCACAGCCTACATGTTGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTTCTGTGCCAGGTCCAGCTACAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACCTTC............ACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTTTCCTGGA......AGTGGTAGTACTTACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTTACTGTAGACAAATCCTCCAGCACAGCCTACATGTTGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTTCTGTGC
IGHV-HKNQ 12022-05-15IGHV1-74*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-32FNOD/ShiLtJCAGGTCCAACTGCAGCAGCCTGGGGCTGAACTGGTGAAGCCTGGGGCTTCAGTGAAGGTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGCCAAGGCCTTGAGTGGATTGGAAGGATTCATCCTTCTGATAGTGATACTAACTACAATCAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAACAGGTCCAACTGCAGCAGCCTGGGGCT...GAACTGGTGAAGCCTGGGGCTTCAGTGAAGGTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGCCAAGGCCTTGAGTGGATTGGAAGGATTCATCCTTCT......GATAGTGATACTAACTACAATCAAAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAA
IGHV-HUUQ 12022-05-15IGHV8-2*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV8-2FNOD/ShiLtJCAGGTTACTCTGAAAGTGTCTGGCCCTGGGATATTGCAGCCATCACAGACTCTCAGCCTGGCCTGTACTTTCTCTGGGATTTCACTGAGTACTTCTGGTATGGGTTTGAGCTGGCTTCGTAAGCCCTCAGGGAAGGCTTTAGAGTGGCTGGCAAGCATTTGGAATAATGATAACTACTACAACCCATCTTTGAAGAGCCGGCTCACAATCTCCAAGGAGACCTCCAACTACCAAGTATTCCTTAAACTCACCAGTGTGGACACTGCAGATTCTGCCACATACTACGGTGCTTGGAGAGACAGGTTACTCTGAAAGTGTCTGGCCCT...GGGATATTGCAGCCATCACAGACTCTCAGCCTGGCCTGTACTTTCTCTGGGATTTCACTGAGT......ACTTCTGGTATGGGTTTGAGCTGGCTTCGTAAGCCCTCAGGGAAGGCTTTAGAGTGGCTGGCAAGCATTTGGAAT............AATGATAACTACTACAACCCATCTTTGAAG...AGCCGGCTCACAATCTCCAAGGAGACCTCCAACTACCAAGTATTCCTTAAACTCACCAGTGTGGACACTGCAGATTCTGCCACATACTACGGTGCTTGGAGAGA
IGHV-J7CF 12022-05-15IGHV6-6*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV6-2FNOD/ShiLtJGAAGTGAAGCTTGAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCTTGTGCTGCCTCTGGATTCACTTTTAGTGACGCCTGGATGGACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTGAAATTAGAAACAAAGCTAATAATCATGCAACATACTATGCTGAGTCTGTGAAAGGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAGCTTAAGAGCTGAAGACACTGGCATTTATTACTGTGAAGTGAAGCTTGAGGAGTCTGGAGGA...GGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCTTGTGCTGCCTCTGGATTCACTTTT............AGTGACGCCTGGATGGACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTGAAATTAGAAACAAAGCTAATAATCATGCAACATACTATGCTGAGTCTGTGAAA...GGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAGCTTAAGAGCTGAAGACACTGGCATTTATTACTGT
IGHV-K2QM 12022-05-15IGHV13-2*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV13-1FNOD/ShiLtJCAGGTGCAGCTTGTAGAGACCGGGGGAGGCTTGGTGAGGCCTGGAAATTCTCTGAAACTCTCCTGTGTTACCTCGGGATTCACTTTCAGTAACTACCGGATGCACTGGCTTCGCCAGCCTCCAGGGAAGAGGCTGGAGTGGATTGCTGTAATTACAGTCAAATCTGATAATTATGGAGCAAATTATGCAGAGTCTGTGAAAGGCAGATTCGCCATTTCAAGAGATGATTCAAAAAGCAGTGTCTACCTAGAGATGAACAGATTAAGAGAGGAAGACACTGCCACTTATTTTTGTAGTCAGGTGCAGCTTGTAGAGACCGGGGGA...GGCTTGGTGAGGCCTGGAAATTCTCTGAAACTCTCCTGTGTTACCTCGGGATTCACTTTC............AGTAACTACCGGATGCACTGGCTTCGCCAGCCTCCAGGGAAGAGGCTGGAGTGGATTGCTGTAATTACAGTCAAATCTGATAATTATGGAGCAAATTATGCAGAGTCTGTGAAA...GGCAGATTCGCCATTTCAAGAGATGATTCAAAAAGCAGTGTCTACCTAGAGATGAACAGATTAAGAGAGGAAGACACTGCCACTTATTTTTGTAGT
IGHV-KCB3 12022-05-15IGHV3-8*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV3-3FNOD/ShiLtJGAGGTGCAGCTTCAGGAGTCAGGACCTGGCCTGGCAAAACCTTCTCAGACTCTGTCCCTCACCTGTTCTGTCACTGGCTACTCCATCACCAGTGATTACTGGAACTGGATCCGGAAATTCCCAGGGAATAAACTTGAGTACATGGGGTACATAAGCTACAGTGGTAGCACTTACTACAATCCATCTCTCAAAAGTCGAATCTCCATAACTCGAGACACATCCAAGAACCAGTATTACCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCAGAGGTGCAGCTTCAGGAGTCAGGACCT...GGCCTGGCAAAACCTTCTCAGACTCTGTCCCTCACCTGTTCTGTCACTGGCTACTCCATC............ACCAGTGATTACTGGAACTGGATCCGGAAATTCCCAGGGAATAAACTTGAGTACATGGGGTACATAAGCTACAGT.........GGTAGCACTTACTACAATCCATCTCTCAAA...AGTCGAATCTCCATAACTCGAGACACATCCAAGAACCAGTATTACCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCA
IGHV-KZTT 12022-05-15IGHV5-4*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV5-6FNOD/ShiLtJGAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGCCATGTCTTGGGTTCGCCAGACTCCGGAAAAGAGGCTGGAGTGGGTCGCAACCATTAGTGATGGTGGTAGTTACACCTACTATCCAGACAATGTAAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACAACCTGTACCTGCAAATGAGCCATCTGAAGTCTGAGGACACAGCCATGTATTACTGTGCAAGGAAGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATGCCATGTCTTGGGTTCGCCAGACTCCGGAAAAGAGGCTGGAGTGGGTCGCAACCATTAGTGATGGT......GGTAGTTACACCTACTATCCAGACAATGTAAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACAACCTGTACCTGCAAATGAGCCATCTGAAGTCTGAGGACACAGCCATGTATTACTGTGCAAG
IGHV-LFNP 12022-05-15IGHV9-2*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV9-2FNOD/ShiLtJCAGATCCAGTTCGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGTGTATACCTTCACAGAATATCCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTCAAGTGGATGGGCTGGATAAACACCTACTCTGGAGAGCCAACATATGCTGACGACTTCAAGGGACGGTTTGCCTTTTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCAACAGATCCAGTTCGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGTGTATACCTTC............ACAGAATATCCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTCAAGTGGATGGGCTGGATAAACACCTAC......TCTGGAGAGCCAACATATGCTGACGACTTCAAG...GGACGGTTTGCCTTTTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCAA
IGHV-LGZV 12022-05-15IGHV1-31*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-9FNOD/ShiLtJGAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGGCTACTACATGCACTGGGTGAAGCAGAGCCATGGAAATATCCTCGATTGGATTGGATATATTTATCCTTACAATGGTGTTTCTAGCTACAACCAGAAATTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCTAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCGAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTC............ACTGGCTACTACATGCACTGGGTGAAGCAGAGCCATGGAAATATCCTCGATTGGATTGGATATATTTATCCTTAC......AATGGTGTTTCTAGCTACAACCAGAAATTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCTAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGC
IGHV-LLIN 12022-05-15IGHV5-2*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV5-5FNOD/ShiLtJGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGAGTCCCTGAAACTCTCCTGTGAATCCAATGAATACGAATTCCCTTCCCATGACATGTCTTGGGTCCGCAAGACTCCGGAGAAGAGGCTGGAGTTGGTCGCAGCCATTAATAGTGATGGTGGTAGCACCTACTATCCAGACACCATGGAGAGACGATTCATCATCTCCAGAGACAATACCAAGAAGACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACAGCCTTGTATTACTGTGCAAGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGAGTCCCTGAAACTCTCCTGTGAATCCAATGAATACGAATTC............CCTTCCCATGACATGTCTTGGGTCCGCAAGACTCCGGAGAAGAGGCTGGAGTTGGTCGCAGCCATTAATAGTGAT......GGTGGTAGCACCTACTATCCAGACACCATGGAG...AGACGATTCATCATCTCCAGAGACAATACCAAGAAGACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACAGCCTTGTATTACTGTGCAA
IGHV-LR6W 12022-05-15IGHV5-15*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV5-2FNOD/ShiLtJGAGGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTACGGAATGGCGTGGGTTCGACAGGCTCCAAGGAAGGGGCCTGAGTGGGTAGCATTCATTAGTAATTTGGCATATAGTATCTACTATGCAGACACTGTGACGGGCCGATTCACCATCTCTAGAGAGAATGCCAAGAACACCCTGTACCTGGAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGCAGAGGTGAAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTGACTACGGAATGGCGTGGGTTCGACAGGCTCCAAGGAAGGGGCCTGAGTGGGTAGCATTCATTAGTAATTTG......GCATATAGTATCTACTATGCAGACACTGTGACG...GGCCGATTCACCATCTCTAGAGAGAATGCCAAGAACACCCTGTACCTGGAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGCA
IGHV-LS7B 12022-05-15IGHV1-34*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-10FNOD/ShiLtJGAGGTCCAGCTGCAACAGTCTGGACCTGAGTTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACATTCACTGACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTTATCCTAACAATGGTGGTAATGGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGGAGGTCCAGCTGCAACAGTCTGGACCT...GAGTTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACATTC............ACTGACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTTATCCTAAC......AATGGTGGTAATGGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAG
IGHV-M2WG 12022-05-15IGHV5-9*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV5-9FNOD/ShiLtJGAAGTGATGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATACCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTGGTGGTGGTGGTAACACCTACTATCCAGACAGTGTGAAGGGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCTTGTATTACTGTGCAAGGAAGTGATGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATACCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTGGTGGT......GGTGGTAACACCTACTATCCAGACAGTGTGAAG...GGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCTTGTATTACTGTGCAAG
IGHV-ME3W 12022-05-15IGHV1-11*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-1FNOD/ShiLtJCAGATCCAGCTGCAACAGTCAGGAGCTGAGCTGGCGAGTCCTGGGGCATCAGTGACACTGTCCTGCAAGGCTTCTGGCTACACATTTACTGACCATATTATGAATTGGGTAAAAAAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAAGGATTTATCCAGTAAGTGGTGAAACTAACTACAATCAAAAGTTCATGGGCAAGGCCACATTCTCTGTAGACCGGTCCTCCAGCACAGTGTACATGGTGTTGAACAGCCTGACATCTGAGGACCCTGCTGTCTATTACTGTGGAAGGCAGATCCAGCTGCAACAGTCAGGAGCT...GAGCTGGCGAGTCCTGGGGCATCAGTGACACTGTCCTGCAAGGCTTCTGGCTACACATTT............ACTGACCATATTATGAATTGGGTAAAAAAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAAGGATTTATCCAGTA......AGTGGTGAAACTAACTACAATCAAAAGTTCATG...GGCAAGGCCACATTCTCTGTAGACCGGTCCTCCAGCACAGTGTACATGGTGTTGAACAGCCTGACATCTGAGGACCCTGCTGTCTATTACTGTGGAAGG
IGHV-MH5Z 12022-05-15IGHV1-5*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-16FNOD/ShiLtJGAGGTTCAGCTCCAGCAGTCTGGGACTGTGCTGGCAAGGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGACTTCTGGCTACACATTTACCAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATAGGGGCTATTTATCCTGGAAATAGTGATACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCAAACTGACTGCAGTCACATCCGCCAGCACTGCCTACATGGAGCTCAGCAGCCTGACAAATGAGGACTCTGCGGTCTATTACTGTACAAGAGGTTCAGCTCCAGCAGTCTGGGACT...GTGCTGGCAAGGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGACTTCTGGCTACACATTT............ACCAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATAGGGGCTATTTATCCTGGA......AATAGTGATACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCAAACTGACTGCAGTCACATCCGCCAGCACTGCCTACATGGAGCTCAGCAGCCTGACAAATGAGGACTCTGCGGTCTATTACTGTACAA
IGHV-MND7 12022-05-15IGHV14-1*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV14-1FNOD/ShiLtJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAGACTACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAGGATGGTGATACTGAATATGCCCCGAAGTTCCAGGGCAAGGCCACTATGACTGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTACTGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAGACTACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAG......GATGGTGATACTGAATATGCCCCGAAGTTCCAG...GGCAAGGCCACTATGACTGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTACT
IGHV-MZLP 12022-05-15IGHV1-58*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-22FNOD/ShiLtJGAGGTCCAGCTTCAGCAGTCTGGAGCTGAGCTGGTGAGGCCTGGGTCCTCAGTGAAGATGTCCTGCAAGACTTCTGGATATACATTCACAAGCTACGGTATAAACTGGGTGAAGCAGAGGCCTGGACAGGGCCTGGAATGGATTGGATATATTTATATTGGAAATGGTTATACTGAGTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTTCAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAATCTATTTCTGTGCAAGAGGTCCAGCTTCAGCAGTCTGGAGCT...GAGCTGGTGAGGCCTGGGTCCTCAGTGAAGATGTCCTGCAAGACTTCTGGATATACATTC............ACAAGCTACGGTATAAACTGGGTGAAGCAGAGGCCTGGACAGGGCCTGGAATGGATTGGATATATTTATATTGGA......AATGGTTATACTGAGTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTTCAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAATCTATTTCTGTGCAA
IGHV-N2YY 12022-05-15IGHV2-4*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV2-3FNOD/ShiLtJCAGGTGCAGCTGAAGCAGTCAGGACCTGGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTAACTAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGTGGAAGCACAGACTATAATGCTGCTTTCATATCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACTGCCATATACTACTGTGCCCAGGTGCAGCTGAAGCAGTCAGGACCT...GGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTA............ACTAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGT.........GGAAGCACAGACTATAATGCTGCTTTCATA...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACTGCCATATACTACTGTGCC
IGHV-NDG3 12022-05-15IGHV2-3*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV2-2FNOD/ShiLtJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCAGGGTTCTCATTAACCAGCTATGGTGTAAGCTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGACGGGAGCACAAATTATCATTCAGCTCTCATATCCAGACTGAGCATCAGCAAGGATAACTCCAAGAGCCAAGTTTTCTTAAAACTGAACAGTCTGCAAACTGATGACACAGCCACGTACTACTGTCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCAGGGTTCTCATTA............ACCAGCTATGGTGTAAGCTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGAC.........GGGAGCACAAATTATCATTCAGCTCTCATA...TCCAGACTGAGCATCAGCAAGGATAACTCCAAGAGCCAAGTTTTCTTAAAACTGAACAGTCTGCAAACTGATGACACAGCCACGTACTACTGT
IGHV-NET3 12022-05-15IGHV9-3*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV9-3FNOD/ShiLtJCAGATCCAGTTGGTACAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAACCTATGGAATGAGCTGGGTGAAACAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCTACTCTGGAGTGCCAACATATGCTGATGACTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCCAGATCCAGTTGGTACAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACAACCTATGGAATGAGCTGGGTGAAACAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCTAC......TCTGGAGTGCCAACATATGCTGATGACTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGC
IGHV-NFTL 12022-05-15IGHV11-2*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV11-1FNOD/ShiLtJGAAGTGCAGCTGTTGGAGACTGGAGGAGGCTTGGTGCAACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTTAGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGATGGCAGTGCAATAAACTACGCACCATCCATAAAGGATCGATTCACTATCTTCAGAGACAATGACAAGAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCGGAGGACACAGCCACGTATTTCTGTAGAAGTGCAGCTGTTGGAGACTGGAGGA...GGCTTGGTGCAACCTGGGGGGTCACGGGGACTCTCTTGTGAAGGCTCAGGGTTCACTTTT............AGTGGCTTCTGGATGAGCTGGGTTCGACAGACACCTGGGAAGACCCTGGAGTGGATTGGAGACATTAATTCTGAT......GGCAGTGCAATAAACTACGCACCATCCATAAAG...GATCGATTCACTATCTTCAGAGACAATGACAAGAGCACCCTGTACCTGCAGATGAGCAATGTGCGATCGGAGGACACAGCCACGTATTTCTGTA
IGHV-NSFI 12022-05-15IGHV1-42*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-14FNOD/ShiLtJGAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGGCTACTACATGAACTGGGTGAAGCAAAGTCCTGAAAAGAGCCTTGAGTGGATTGGAGAGATTAATCCTAGCACTGGTGGTACTACCTACAACCAGAAGTTCAAGGCCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAAGAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAGAGGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTC............ACTGGCTACTACATGAACTGGGTGAAGCAAAGTCCTGAAAAGAGCCTTGAGTGGATTGGAGAGATTAATCCTAGC......ACTGGTGGTACTACCTACAACCAGAAGTTCAAG...GCCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAAGAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCA
IGHV-NYJ5 12022-05-15IGHV8-5*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV8-3FNOD/ShiLtJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTCTAATATGGGTATAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTAGAGTGGCTGGCACACATTTGGTGGAATGATGATAAGTACTATAACCCATCCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAACAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCAAATCAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTCTAATATGGGTATAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTAGAGTGGCTGGCACACATTTGGTGGAAT.........GATGATAAGTACTATAACCCATCCCTGAAG...AGCCGGCTCACAATCTCCAAGGATACCTCCAACAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCAAAT
IGHV-OJQ5 12022-05-15IGHV2-2*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV2-1FNOD/ShiLtJCAGGTGCAGCTGAAGCAGTCAGGACCTGGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTAACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGTGGAAGCACAGACTATAATGCAGCTTTCATATCCAGACTGAGCATCAGCAAGGACAATTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATATTACTGTGCCCAGGTGCAGCTGAAGCAGTCAGGACCT...GGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTA............ACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGT.........GGAAGCACAGACTATAATGCAGCTTTCATA...TCCAGACTGAGCATCAGCAAGGACAATTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATATTACTGTGCC
IGHV-OOBY 12022-05-15IGHV3-6*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV3-2FNOD/ShiLtJGATGTACAGCTTCAGGAGTCAGGACCTGGCCTCGTGAAACCTTCTCAGTCTCTGTCTCTCACCTGCTCTGTCACTGGCTACTCCATCACCAGTGGTTATTACTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAATGGATGGGCTACATAAGCTACGATGGTAGCAATAACTACAACCCATCTCTCAAAAATCGAATCTCCATCACTCGTGACACATCTAAGAACCAGTTTTTCCTGAAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGATGTACAGCTTCAGGAGTCAGGACCT...GGCCTCGTGAAACCTTCTCAGTCTCTGTCTCTCACCTGCTCTGTCACTGGCTACTCCATCACC.........AGTGGTTATTACTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAATGGATGGGCTACATAAGCTACGAT.........GGTAGCAATAACTACAACCCATCTCTCAAA...AATCGAATCTCCATCACTCGTGACACATCTAAGAACCAGTTTTTCCTGAAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGT
IGHV-OXE6 12022-05-15IGHV1-81*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-38FNOD/ShiLtJCAGGTTCAGCTGCAGCAGTCTGGAGCTGAGCTGGCGAGGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACAAGCTATGGTATAAGCTGGGTGAAGCAGAGAACTGGACAGGGCCTTGAGTGGATTGGAGAGATTTATCCTAGAAGTGGTAATACTTACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCGTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCCAGGTTCAGCTGCAGCAGTCTGGAGCT...GAGCTGGCGAGGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACAAGCTATGGTATAAGCTGGGTGAAGCAGAGAACTGGACAGGGCCTTGAGTGGATTGGAGAGATTTATCCTAGA......AGTGGTAATACTTACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCGTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGC
IGHV-RCX7 12022-05-15IGHV1-66*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-28FNOD/ShiLtJCAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACAGCTTCACAAGCTACTATATACACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTGGAAGTGGTAATACTAAGTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACGGCAGACACATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTAACATCTGAGGACTCTGCGGTCTATTACTGTGCAGGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACAGCTTC............ACAAGCTACTATATACACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTGGA......AGTGGTAATACTAAGTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACGGCAGACACATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTAACATCTGAGGACTCTGCGGTCTATTACTGTG
IGHV-RO7L 12022-05-15IGHV5-17*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV5-4FNOD/ShiLtJGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTATGGAATGCACTGGGTTCGTCAGGCTCCAGAGAAGGGGCTGGAGTGGGTTGCATACATTAGTAGTGGCAGTAGTACCATCTACTATGCAGACACAGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTTCCTGCAAATGACCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTGACTATGGAATGCACTGGGTTCGTCAGGCTCCAGAGAAGGGGCTGGAGTGGGTTGCATACATTAGTAGTGGC......AGTAGTACCATCTACTATGCAGACACAGTGAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTTCCTGCAAATGACCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGT
IGHV-T7RS 12022-05-15IGHV1-85*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-40FNOD/ShiLtJCAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTCACAAGCTACGATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTAGAGATGGTAGTACTAAGTACAATGAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCGTACATGGAGCTCCACAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCAAGCAGGTTCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACAAGCTACGATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTAGA......GATGGTAGTACTAAGTACAATGAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCGTACATGGAGCTCCACAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCAAG
IGHV-TOZB 12022-05-15IGHV1-53*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-19FNOD/ShiLtJCAGGTCCAACTGCAGCAGCCTGGGACTGAACTGGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTAATCCTAGCAATGGTGGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTGCAGGTCCAACTGCAGCAGCCTGGGACT...GAACTGGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTAATCCTAGC......AATGGTGGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTG
IGHV-TTOW 12022-05-15IGHV5-9-1*02|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV5-8FNOD/ShiLtJGACGTGAAGCTGGTGGAGTCTGGGGAAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGCCATGTCTTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCATACATTAGTAGTGGTGGTGATTACATCTACTATGCAGACACTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAGGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTGACGTGAAGCTGGTGGAGTCTGGGGAA...GGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATGCCATGTCTTGGGTTCGCCAGACTCCAGAGAAGAGGCTGGAGTGGGTCGCATACATTAGTAGTGGT......GGTGATTACATCTACTATGCAGACACTGTGAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAGGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGT
IGHV-UHGI 12022-05-15IGHV1-59*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-23FNOD/ShiLtJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTGGTGAGGCCTGGGACTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTAAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATCGGAGTGATTGATCCTTCTGATAGTTATACTAACTACAATCAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTGGTGAGGCCTGGGACTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCACTGGGTAAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATCGGAGTGATTGATCCTTCT......GATAGTTATACTAACTACAATCAAAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGC
IGHV-V2J3 12022-05-15IGHV1-7*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-30FNOD/ShiLtJCAGGTCCAGCTGCAGCAGTCTGGGGCTGAACTGGCAAAACCTGGGGCCTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTTACTAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGCAGTGGTTATACTAAGTACAATCAGAAGTTCAAGGACAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTGAGCAGCCTGACATATGAGGACTCTGCAGTCTATTACTGTGCAAGCAGGTCCAGCTGCAGCAGTCTGGGGCT...GAACTGGCAAAACCTGGGGCCTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTT............ACTAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGC......AGTGGTTATACTAAGTACAATCAGAAGTTCAAG...GACAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTGAGCAGCCTGACATATGAGGACTCTGCAGTCTATTACTGTGCAAG
IGHV-VAZW 12022-05-15IGHV1-47*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-15FNOD/ShiLtJCAGGTTCAGCTGCAGCAGTCTGGGGCTGAGCTAGTGAAGCCTGGAGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTCACTACCTATCCTATAGAGTGGATGAAGCAGAATCATGGAAAGAGCCTAGAGTGGATTGGAAATTTTCATCCTTACAATGATGATACTAAGTACAATGAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGAAAAATCCTCTAGCACAGTCTACTTGGAGCTCAGCCGATTAACATCTGATGACTCTGCTGTTTATTACTGTGCAACAGGTTCAGCTGCAGCAGTCTGGGGCT...GAGCTAGTGAAGCCTGGAGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTC............ACTACCTATCCTATAGAGTGGATGAAGCAGAATCATGGAAAGAGCCTAGAGTGGATTGGAAATTTTCATCCTTAC......AATGATGATACTAAGTACAATGAAAAGTTCAAG...GGCAAGGCCACATTGACTGTAGAAAAATCCTCTAGCACAGTCTACTTGGAGCTCAGCCGATTAACATCTGATGACTCTGCTGTTTATTACTGTGCAA
IGHV-VUEY 12022-05-15IGHV1-54*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-20FNOD/ShiLtJCAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTAAGGCCTGGGACTTCAGTGAAGGTGTCCTGCAAGGCTTCTGGATACGCCTTCACTAATTACTTGATAGAGTGGGTAAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAGTGATTAATCCTGGAAGTGGTGGTACTAACTACAATGAGAAGTTCAAGGGCAAGGCAACACTGACTGCAGACAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCCAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTAAGGCCTGGGACTTCAGTGAAGGTGTCCTGCAAGGCTTCTGGATACGCCTTC............ACTAATTACTTGATAGAGTGGGTAAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAGTGATTAATCCTGGA......AGTGGTGGTACTAACTACAATGAGAAGTTCAAG...GGCAAGGCAACACTGACTGCAGACAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGC
IGHV-VUQE 12022-05-15IGHV1-22*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-7FNOD/ShiLtJGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTGACTACAACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTAACCCTAACAATGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAAACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCGGAGGATTCTGCAGTCTATTACTGTGAGGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACAACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTAACCCTAAC......AATGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAAACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCGGAGGATTCTGCAGTCTATTACTGT
IGHV-WVZG 12022-05-15IGHV1-77*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-35FNOD/ShiLtJCAGGTCCAGCTGAAGCAGTCTGGAGCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACCTTCACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAAAGATTGGTCCTGGAAGTGGTAGTACTTACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCAGGTCCAGCTGAAGCAGTCTGGAGCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACCTTC............ACTGACTACTATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGCCTTGAGTGGATTGGAAAGATTGGTCCTGGA......AGTGGTAGTACTTACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTG
IGHV-WXSZ 12022-05-15IGHV1-12*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-2FNOD/ShiLtJCAGGCTTATCTACAGCAGTCTGGGGCTGAGCTGGTGAGGCCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACATTTACCAGTTACAATATGCACTGGGTAAAGCAGACACCTAGACAGGGCCTGGAATGGATTGGAGCTATTTATCCAGGAAATGGTGATACTTCCTACAATCAGAAGTTCAAGGGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCCAGGCTTATCTACAGCAGTCTGGGGCT...GAGCTGGTGAGGCCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACATTT............ACCAGTTACAATATGCACTGGGTAAAGCAGACACCTAGACAGGGCCTGGAATGGATTGGAGCTATTTATCCAGGA......AATGGTGATACTTCCTACAATCAGAAGTTCAAG...GGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAAGACTCTGCGGTCTATTTCTGTGC
IGHV-XOLY 12022-05-15IGHV1-50*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-17FNOD/ShiLtJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCAGTGGGTAAAACAGAGGCCTGGACAGGGCCTTGAGTGGATCGGAGAGATTGATCCTTCTGATAGCTATACTAACTACAATCAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGCAGTGGGTAAAACAGAGGCCTGGACAGGGCCTTGAGTGGATCGGAGAGATTGATCCTTCT......GATAGCTATACTAACTACAATCAAAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGC
IGHV-XRD4 12022-05-15IGHV1-62-2*01|Mus_musculus_C57BL/6,IGHV1-71*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-25FNOD/ShiLtJCAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTGAAACCCGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACTGAGTATACTATACACTGGGTAAAGCAGAGGTCTGGACAGGGTCTTGAGTGGATTGGGTGGTTTTACCCTGGAAGTGGTAGTATAAAGTACAATGAGAAATTCAAGGACAAGGCCACATTGACTGCGGACAAATCCTCCAGCACAGTCTATATGGAGCTTAGTAGATTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGACACGCAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTGAAACCCGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACTGAGTATACTATACACTGGGTAAAGCAGAGGTCTGGACAGGGTCTTGAGTGGATTGGGTGGTTTTACCCTGGA......AGTGGTAGTATAAAGTACAATGAGAAATTCAAG...GACAAGGCCACATTGACTGCGGACAAATCCTCCAGCACAGTCTATATGGAGCTTAGTAGATTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGACACG
IGHV-XYBY 12022-05-15IGHV4-1*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV4-1FNOD/ShiLtJGAGGTGAAGCTTCTCCAGTCTGGAGGTGGCCTGGTGCAGCCTGGAGGATCCCTGAAACTCTCCTGTGCAGCCTCAGGAATCGATTTTAGTAGATACTGGATGAGTTGGGTTCGGCGGGCTCCAGGGAAAGGACTAGAATGGATTGGAGAAATTAATCCAGATAGCAGTACAATAAACTATGCACCATCTCTAAAGGATAAATTCATCATCTCCAGAGACAACGCCAAAAATACGCTGTACCTGCAAATGAGCAAAGTGAGATCTGAGGACACAGCCCTTTATTACTGTGCAGAGGTGAAGCTTCTCCAGTCTGGAGGT...GGCCTGGTGCAGCCTGGAGGATCCCTGAAACTCTCCTGTGCAGCCTCAGGAATCGATTTT............AGTAGATACTGGATGAGTTGGGTTCGGCGGGCTCCAGGGAAAGGACTAGAATGGATTGGAGAAATTAATCCAGAT......AGCAGTACAATAAACTATGCACCATCTCTAAAG...GATAAATTCATCATCTCCAGAGACAACGCCAAAAATACGCTGTACCTGCAAATGAGCAAAGTGAGATCTGAGGACACAGCCCTTTATTACTGTGCA
IGHV-YH3T 12022-05-15IGHV8-12*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV8-1FNOD/ShiLtJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGTCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTCTGGTATGGGTGTGAGCTGGATTCGTCAGCCTTCAGGAAAGGGTCTGGAGTGGCTGGCACACATTTACTGGGATGATGACAAGCGCTATAACCCATCCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAGAAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGTCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTCTGGTATGGGTGTGAGCTGGATTCGTCAGCCTTCAGGAAAGGGTCTGGAGTGGCTGGCACACATTTACTGGGAT.........GATGACAAGCGCTATAACCCATCCCTGAAG...AGCCGGCTCACAATCTCCAAGGATACCTCCAGAAACCAGGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACTGTG
IGHV-ZCVZ 12022-05-15IGHV1-19*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV1-5FNOD/ShiLtJGAGGTCCAGCTGCAACAGTCTGGACCTGTGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTCACTGACTACTATATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGTTATTAATCCTTACAACGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTTGACAAGTCCTCCAGCACAGCCTACATGGAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCGAGGTCCAGCTGCAACAGTCTGGACCT...GTGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGTAAGGCTTCTGGATACACATTC............ACTGACTACTATATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGTTATTAATCCTTAC......AACGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTTGACAAGTCCTCCAGCACAGCCTACATGGAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGC
IGHV-ZU34 12022-05-15IGHV3-1*01|Mus_musculus_C57BL/6watson_et_al:NOD_ShiLtJ_IGHV3-1FNOD/ShiLtJGATGTGCAGCTTCAGGAGTCAGGACCTGGCATGGTGAAACCTTCTCAGTCACTTTCCCTCACCTGCACTGTCACTGGCTACTCCATCACCAGTGGTTATGACTGGCACTGGATCCGACATTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGTGGTAGCACTAACTACAACCCATCCCTCAAAAGTCGAATCTCCATCACTCATGACACATCTAAGAACCATTTCTTCCTGAAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCAAGGATGTGCAGCTTCAGGAGTCAGGACCT...GGCATGGTGAAACCTTCTCAGTCACTTTCCCTCACCTGCACTGTCACTGGCTACTCCATCACC.........AGTGGTTATGACTGGCACTGGATCCGACATTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGT.........GGTAGCACTAACTACAACCCATCCCTCAAA...AGTCGAATCTCCATCACTCATGACACATCTAAGAACCATTTCTTCCTGAAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCAAG

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

History

History logs the times and reasons for the publication of each version of this germline set. Key changes are noted. For detailed changes, click on the link to the sequence.

William Lees
2022-05-15 16:07:13
Mouse germline set G00052 (NOD/ShiLtJ IGH) created

Mouse germline set G00052 (NOD/ShiLtJ IGH) created

William Lees
2022-05-15 16:10:56
Version 1 published

First release

Versions

All published versions of this germline set.

Set NameSpeciesSpecies subgroupLocusRelease VersionRelease Date
NOD/ShiLtJ IGHMouseNOD/ShiLtJIGH12022-05-15