Notes

The germline set is based on sequences published in Watson et al. (2019)

Details

AuthorWilliam Lees
Lab Name
Lab AddressBirkbeck College, University of London, Malet Street, London
NameLEWES/EiJ IGH
SpeciesMouse
Species subgroupLEWES/EiJ
Subgroup typestrain
LocusIGH
Release Version1
Release DescriptionIGH sequences as described in Watson et al. (2019)
Release Date2022-05-14

Included Sequences

LabelVnDateIMGT NameAlt NamesFunctionalitySubgrpSequenceGapped Sequence
IGHD-2LU5 12022-05-14watson_et_al:LEWES_EiJ_IGHD2-3_varFLEWES/EiJTCTATGGTGGTTACTACTCTATGGTGGTTACTAC
IGHD-4RNO 12022-05-14IGHD2-4*01|Mus_musculus_BALB/c,IGHD2-9*02|Mus_musculus_129/Svwatson_et_al:LEWES_EiJ_IGHD2-4*01|IGHD2-9*02FLEWES/EiJTCTACTATGATTACGACTCTACTATGATTACGAC
IGHD-7EZJ 12022-05-14IGHD2-1*01|Mus_musculus_129/Sv,IGHD2-8*01|Mus_musculus_BALB/cwatson_et_al:LEWES_EiJ_IGHD2-1*01|IGHD2-8*01FLEWES/EiJTCTACTATGGTAACTACTCTACTATGGTAACTAC
IGHD-BQKT 12022-05-14IGHD4-1*02|Mus_musculus_BALB/cwatson_et_al:LEWES_EiJ_IGHD4-1*02FLEWES/EiJCAACTGGGACCAACTGGGAC
IGHD-HGKM 12022-05-14IGHD1-2*01|Mus_musculus_BALB/cwatson_et_al:LEWES_EiJ_IGHD1-2*01FLEWES/EiJTTCATTACTACGGCTACTTCATTACTACGGCTAC
IGHD-INWF 12022-05-14IGHD2-5*01|Mus_musculus_CB.20,IGHD2-6*01|Mus_musculus_C57BL/6Jwatson_et_al:LEWES_EiJ_IGHD2-5*01|IGHD2-6*01FLEWES/EiJCCTACTATAGTAACTACCCTACTATAGTAACTAC
IGHD-K7CQ 12022-05-14IGHD2-12*01|Mus_musculus_MRL/lprwatson_et_al:LEWES_EiJ_IGHD2-12*01FLEWES/EiJCCTACTATAGTTACTATAGTTACGACCCTACTATAGTTACTATAGTTACGAC
IGHD-PN6H 12022-05-14IGHD4-1*01|Mus_musculus_BALB/cwatson_et_al:LEWES_EiJ_IGHD4-1*01FLEWES/EiJCTAACTGGGACCTAACTGGGAC
IGHD-TI4I 12022-05-14IGHD3-2*01|Mus_musculus_BALB/cwatson_et_al:LEWES_EiJ_IGHD3-2*01FLEWES/EiJAGACAGCTCGGGCTACAGACAGCTCGGGCTAC
IGHD-U5U7 12022-05-14IGHD2-14*01|Mus_musculus_129/Svwatson_et_al:LEWES_EiJ_IGHD2-14*01FLEWES/EiJCCTACTATAGGTACGACCCTACTATAGGTACGAC
IGHD-XRGU 12022-05-14watson_et_al:LEWES_EiJ_IGHD1-1_varFLEWES/EiJTTTATTACTACGATGGTAGCTACTTTATTACTACGATGGTAGCTAC
IGHJ-2FQV 12022-05-14IGHJ2*01|Mus_musculuswatson_et_al:LEWES_EiJ_IGHJ2*02FLEWES/EiJACTACTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAGACTACTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAG
IGHJ-FJ4Z 12022-05-14IGHJ4*01|Mus_musculuswatson_et_al:LEWES_EiJ_IGHJ4*01FLEWES/EiJATTACTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGATTACTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAG
IGHJ-K2IX 12022-05-14IGHJ1*03|Mus_musculus_A/Jwatson_et_al:LEWES_EiJ_IGHJ1*03FLEWES/EiJCTACTGGTACTTCGATGTCTGGGGCACAGGGACCACGGTCACCGTCTCCTCAGCTACTGGTACTTCGATGTCTGGGGCACAGGGACCACGGTCACCGTCTCCTCAG
IGHJ-KZ3G 12022-05-14IGHJ3*01|Mus_musculuswatson_et_al:LEWES_EiJ_IGHJ3*01FLEWES/EiJCCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAGCCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAG
IGHV-2TS3 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-14FLEWES/EiJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTCACCCGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTTATCCTGGTAGAGGTAGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCCGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTTATCCTGGT......AGAGGTAGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGC
IGHV-2XKZ 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-1FLEWES/EiJCAGGTGCAACTGCAGCAGCCTGGGGCTGAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACATTTACCAGTTACAATATGCACTGGGTAAAGCAGACACCTGGACAGGGCCTGGAATGGATTGGAGCTATTTATCCAGGAAATGGTGATACTTCCTACAATCAGAAGTTCAAGGGCAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAAGCAGGTGCAACTGCAGCAGCCTGGGGCT...GAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACATTT............ACCAGTTACAATATGCACTGGGTAAAGCAGACACCTGGACAGGGCCTGGAATGGATTGGAGCTATTTATCCAGGA......AATGGTGATACTTCCTACAATCAGAAGTTCAAG...GGCAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAAG
IGHV-2ZNU 12022-05-14watson_et_al:LEWES_EiJ_IGHV4-2FLEWES/EiJGAGGTGAAGCTTCTCGAGTCTGGAGGTGGCCTGGTGCAGCCTGGAGGATCCCTGAATCTCTCTTGTGCAGCCTCAGGATTCGATTTTAGTAAAGACTGGATGAGTTGGGTCCGGCAGGCTCCAGGGAAAGGGCTAGAATGGATTGGAGAAATTAATCCAGGTAGCAGTACGATAAACTATGCACCATCTCTAAAGGATAAATTCATCATCTCCAGAGACAACGCCAAAAATACGCTGTACCTGCAAATGAGCAAAGTGAGATCTGAGGACACAGCCCTTTATTACTGTGGAGGTGAAGCTTCTCGAGTCTGGAGGT...GGCCTGGTGCAGCCTGGAGGATCCCTGAATCTCTCTTGTGCAGCCTCAGGATTCGATTTT............AGTAAAGACTGGATGAGTTGGGTCCGGCAGGCTCCAGGGAAAGGGCTAGAATGGATTGGAGAAATTAATCCAGGT......AGCAGTACGATAAACTATGCACCATCTCTAAAG...GATAAATTCATCATCTCCAGAGACAACGCCAAAAATACGCTGTACCTGCAAATGAGCAAAGTGAGATCTGAGGACACAGCCCTTTATTACTGTG
IGHV-3AP5 12022-05-14IGHV7-1*02|Mus_musculus_129/Svwatson_et_al:LEWES_EiJ_IGHV7-1FLEWES/EiJGAGGTGAAGCTGGTGGAATCTGGAGGAGGCTTGGTACAGCCTGGGGGTTCTCTGAGACTCTCCTGTGCAACTTCTGGGTTCACCTTCAGTGATTTCTACATGGAGTGGGTCCGCCAGCCTCCAGGGAAGAGACTGGAGTGGATTGCTGCAAGTAGAAACAAAGCTAATGATTATACAACAGAGTACAGTGCATCTGTGAAGGGTCGGTTCATCGTCTCCAGAGACACTTCCCAAAGCATCCTCTACCTTCAGATGAATGCCCTGAGAGCTGAGGACACTGCCATTTATTACTGTGCAAGAGAGGTGAAGCTGGTGGAATCTGGAGGA...GGCTTGGTACAGCCTGGGGGTTCTCTGAGACTCTCCTGTGCAACTTCTGGGTTCACCTTC............AGTGATTTCTACATGGAGTGGGTCCGCCAGCCTCCAGGGAAGAGACTGGAGTGGATTGCTGCAAGTAGAAACAAAGCTAATGATTATACAACAGAGTACAGTGCATCTGTGAAG...GGTCGGTTCATCGTCTCCAGAGACACTTCCCAAAGCATCCTCTACCTTCAGATGAATGCCCTGAGAGCTGAGGACACTGCCATTTATTACTGTGCAAGA
IGHV-3D4L 12022-05-14watson_et_al:LEWES_EiJ_IGHV8-3FLEWES/EiJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCATCACAGACGCTCAGCCTGGCCTGTACTTTCTCTGGGATTTCACTGAGTACTTCTGGTATGGGTTTGAGCTGGCTTCGTAAGCCCTCAGGGAAGGCTTTAGAGTGGCTGGCAAGCATTTGGAATAATGATAACTACTACAACCCATCTTTGAAGAGCCGGCTCACAATCTCCAAGGAGACCTCCAACAACCAAGTATTCCTTAAACTCACCAGTGTGGACACTGCAGATTCTGCCACATACTACTGTGCTTGGAGACAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCATCACAGACGCTCAGCCTGGCCTGTACTTTCTCTGGGATTTCACTGAGT......ACTTCTGGTATGGGTTTGAGCTGGCTTCGTAAGCCCTCAGGGAAGGCTTTAGAGTGGCTGGCAAGCATTTGGAAT............AATGATAACTACTACAACCCATCTTTGAAG...AGCCGGCTCACAATCTCCAAGGAGACCTCCAACAACCAAGTATTCCTTAAACTCACCAGTGTGGACACTGCAGATTCTGCCACATACTACTGTGCTTGGAGA
IGHV-3JO6 12022-05-14IGHV3-2*02|Mus_musculus_129/Svwatson_et_al:LEWES_EiJ_IGHV3-3FLEWES/EiJGATGTGCAGCTTCAGGAGTCGGGACCTGGCCTGGTGAAACCTTCTCAGTCTCTGTCCCTCACCTGCACTGTCACTGGCTACTCAATCACCAGTGATTATGCCTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGTGGTAGCACTAGCTACAACCCATCTCTCAAAAGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTTCCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGGATGTGCAGCTTCAGGAGTCGGGACCT...GGCCTGGTGAAACCTTCTCAGTCTCTGTCCCTCACCTGCACTGTCACTGGCTACTCAATCACC.........AGTGATTATGCCTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTACAGT.........GGTAGCACTAGCTACAACCCATCTCTCAAA...AGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTTCCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTG
IGHV-3KZH 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-16FLEWES/EiJGAGGTCCAGCTTCAGCAGTCTGGAGCTGAGCTGGTGACGCCTGGGTACTCAGTGAAGCTGTCCTGCAAGACTTCTGGATATACATTCACAAGCTATGATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGCCTGGAATGGATTGGATATATTTATCCTGGAAATGGTTATACTGAGTACAATGAGATGTTCAAGGGCAAGGCCACACTGACTTCAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGAAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCAAGAGAGGTCCAGCTTCAGCAGTCTGGAGCT...GAGCTGGTGACGCCTGGGTACTCAGTGAAGCTGTCCTGCAAGACTTCTGGATATACATTC............ACAAGCTATGATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGCCTGGAATGGATTGGATATATTTATCCTGGA......AATGGTTATACTGAGTACAATGAGATGTTCAAG...GGCAAGGCCACACTGACTTCAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGAAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCAAGA
IGHV-3SZZ 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-20FLEWES/EiJCAGGTCCAGCTGCAGCAGTCTGGGCCTGAGCTGGTGAGGCCTGGGGTCTCAGTGAAGATTTCCTGCAAGGGTTCCGGCTACACATTCACTGATTATGCTATGCACTGGGTGAAGCAGAGTCATGCAAAGAGTCTAGAGTGGATAGGAGTTATTAGTACTTACTATGGTAATACAAACTACAACCAGAAGTTTAAGGGCAAGGCCACAATGACTGTAGACAAATCCTCCAGCACAGCCTATATGGAACTTGCCAGATTGACATCTGAGGATTCTGCCATCTATTACTGTGCAAGCAGGTCCAGCTGCAGCAGTCTGGGCCT...GAGCTGGTGAGGCCTGGGGTCTCAGTGAAGATTTCCTGCAAGGGTTCCGGCTACACATTC............ACTGATTATGCTATGCACTGGGTGAAGCAGAGTCATGCAAAGAGTCTAGAGTGGATAGGAGTTATTAGTACTTAC......TATGGTAATACAAACTACAACCAGAAGTTTAAG...GGCAAGGCCACAATGACTGTAGACAAATCCTCCAGCACAGCCTATATGGAACTTGCCAGATTGACATCTGAGGATTCTGCCATCTATTACTGTGCAAG
IGHV-4GSR 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-17FLEWES/EiJAAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTGAAACCCGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACTGAGTATATTATACACTGGGTAAAGCAGAGGTCTGGACAGGGTCTTGAGTGGATTGGGTGGTTTTACCCTGGAAGTGGTAGTATAAAGTACAATGAGAAATTCAAGGACAAGGCCACATTGACTGCGGACAAATCCTCCAGCACAGTCTATATGGAGCTTAGTAGATTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGACACGAAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTGAAACCCGGGGCATCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACTGAGTATATTATACACTGGGTAAAGCAGAGGTCTGGACAGGGTCTTGAGTGGATTGGGTGGTTTTACCCTGGA......AGTGGTAGTATAAAGTACAATGAGAAATTCAAG...GACAAGGCCACATTGACTGCGGACAAATCCTCCAGCACAGTCTATATGGAGCTTAGTAGATTGACATCTGAAGACTCTGCGGTCTATTTCTGTGCAAGACACG
IGHV-4JDX 12022-05-14watson_et_al:LEWES_EiJ_IGHV5-2FLEWES/EiJGAGTTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTTACATTCAGTAGCCATTTCATGGCATGGGTCCGCCAAACTCCAGAGAAAAGACTGGAGTGGGCCGCAAACATTTATCCTGATGGTGGTACCGCCTACTATCCAAACACTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAGGAATATCATGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGTAAGACAGAGTTGCAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTTACATTC............AGTAGCCATTTCATGGCATGGGTCCGCCAAACTCCAGAGAAAAGACTGGAGTGGGCCGCAAACATTTATCCTGAT......GGTGGTACCGCCTACTATCCAAACACTGTGAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAGGAATATCATGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCATGTATTACTGTGTAAGACA
IGHV-4Q76 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-30FLEWES/EiJCAGGTCCAACTGCAGCAGCCTGGGTCTGTGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTCCTGGATGCACTGGGCGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGAGATTCATCCTAATAGTGGTAATACTAACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACGTGGATCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTCAGGTCCAACTGCAGCAGCCTGGGTCT...GTGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTCCTGGATGCACTGGGCGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGAGATTCATCCTAAT......AGTGGTAATACTAACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACGTGGATCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGT
IGHV-6HGI 12022-05-14watson_et_al:LEWES_EiJ_IGHV9-4FLEWES/EiJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACCAACTATGCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATATACACCAACACTGGAGAGCCAACATATGCTGATGACTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGCCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACCAACTATGCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATATACACCAAC......ACTGGAGAGCCAACATATGCTGATGACTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGC
IGHV-6MYZ 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-13FLEWES/EiJCAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGGTAAGACCTGGGACTTCAGTGAAGGTGTCCTGCAAGGCTTCTGGATACGCCTTCACTAATTACTTGATAGAGTGGGTAAAGCAGAGGCCTGGGCAGGGCCTTGAGTGGATTGGAGTGATTAATCCTGGAAGTGGTGGTACTAACTACAATGAGAAGTTCAAGGGCAAGGCAACACTGACTGCAGACAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGATGACTCTGCGGTCTATTTCTGTGCCAGGTCCAGCTGCAGCAGTCTGGAGCT...GAGCTGGTAAGACCTGGGACTTCAGTGAAGGTGTCCTGCAAGGCTTCTGGATACGCCTTC............ACTAATTACTTGATAGAGTGGGTAAAGCAGAGGCCTGGGCAGGGCCTTGAGTGGATTGGAGTGATTAATCCTGGA......AGTGGTGGTACTAACTACAATGAGAAGTTCAAG...GGCAAGGCAACACTGACTGCAGACAAATCCTCCAGCACTGCCTACATGCAGCTCAGCAGCCTGACATCTGATGACTCTGCGGTCTATTTCTGTGC
IGHV-73MF 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-2FLEWES/EiJCAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTAAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACCTTCGCTAACCATGTTATGCACTGGGTGAAGCAGAAGCCAGGGCAGGGCCTTGAGTGGATTGGATATATTTATCCTTACAATGATGGTACTAAGTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTTCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGGCCTCTGAGGACTCTGCGGTCTATTACTGTGCAACAGGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTAAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACCTTC............GCTAACCATGTTATGCACTGGGTGAAGCAGAAGCCAGGGCAGGGCCTTGAGTGGATTGGATATATTTATCCTTAC......AATGATGGTACTAAGTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTTCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGGCCTCTGAGGACTCTGCGGTCTATTACTGTGCAA
IGHV-ACCO 12022-05-14watson_et_al:LEWES_EiJ_IGHV14-1FLEWES/EiJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCAAGGCTTCTGGCTACACATTTACATACGGCTATCTGCACTGGGTGAAGCAGACTCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGATAATGGTAATACTAAATATGACCCGAAGTTCCAGGGCAAAGCCACTATGACTAGAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTAACATCTGAGGACACTGCTGTCTATTACTGTGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAGGCCAGGGGCCTCAGTCAAGTTGTCCTGCAAGGCTTCTGGCTACACATTT............ACATACGGCTATCTGCACTGGGTGAAGCAGACTCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGAT......AATGGTAATACTAAATATGACCCGAAGTTCCAG...GGCAAAGCCACTATGACTAGAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTAACATCTGAGGACACTGCTGTCTATTACTGT
IGHV-AHDQ 12022-05-14watson_et_al:LEWES_EiJ_IGHV8-1FLEWES/EiJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTTTGATATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCAAACATTTGGTGGAATGATAATAAGTACTATAACTCAGCCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAACAACCAGGTATTCCTCAAGATCTCCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCAAATCAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTTTGATATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCAAACATTTGGTGGAAT.........GATAATAAGTACTATAACTCAGCCCTGAAG...AGCCGGCTCACAATCTCCAAGGATACCTCCAACAACCAGGTATTCCTCAAGATCTCCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCAAAT
IGHV-AS2P 12022-05-14watson_et_al:LEWES_EiJ_IGHV12-1FLEWES/EiJCAGATTCAGCTTAAGGAGTCGGGACCTGCTGTCATCAAGCCATCACAGTCACTGTCTCTCACCTGCACAGTCTCTGGATTCTCCATCACAAGTAGTAGTTATTGCTGGCACTGGATCCGCCAGCCCCCAGGAAAGGGGTTAGAGTGGATGGGGCGCATATGTTATGAAGGTTCAATATACTATAGTCCATCCATCAAAAGCCGCAGCACCATCTCCAGAGACACATCTCTGAACAAATTCTTTATCCAGCTGAGCTCTGTGACAAATGAGGACACAGCCATGTACTACTGTTCCAGGGAAAACCAGATTCAGCTTAAGGAGTCGGGACCT...GCTGTCATCAAGCCATCACAGTCACTGTCTCTCACCTGCACAGTCTCTGGATTCTCCATCACA......AGTAGTAGTTATTGCTGGCACTGGATCCGCCAGCCCCCAGGAAAGGGGTTAGAGTGGATGGGGCGCATATGTTATGAA.........GGTTCAATATACTATAGTCCATCCATCAAA...AGCCGCAGCACCATCTCCAGAGACACATCTCTGAACAAATTCTTTATCCAGCTGAGCTCTGTGACAAATGAGGACACAGCCATGTACTACTGTTCCAGGGAAAAC
IGHV-BCDK 12022-05-14watson_et_al:LEWES_EiJ_IGHV6-3FLEWES/EiJGAGGTGAAGCTGGATGAGACTGGAGGAGGCTTGGTGCAACCTGGGAGGTCCATGAAACTCTCCTGTGTTGCCTCTGGATTCACTTTTAGTGACTACTGGATGAACTGGGTCCGCCAGTCTCCAGAGAAAGGACTGGAGTGGGTAGCACAAATTAGAAACAAACCTTATAATTATGAAACATATTATTCAGATTCTGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAATAACTTAAGAGCTGAAGACATGGGTATCTATTACTGTACGAGGTGAAGCTGGATGAGACTGGAGGA...GGCTTGGTGCAACCTGGGAGGTCCATGAAACTCTCCTGTGTTGCCTCTGGATTCACTTTT............AGTGACTACTGGATGAACTGGGTCCGCCAGTCTCCAGAGAAAGGACTGGAGTGGGTAGCACAAATTAGAAACAAACCTTATAATTATGAAACATATTATTCAGATTCTGTGAAA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAATAACTTAAGAGCTGAAGACATGGGTATCTATTACTGTAC
IGHV-CIDE 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-25FLEWES/EiJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGCATGATTCATCCTTCCGATAGTGAAACTAGGTTAAATCAGAAGTTCAAGGACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCCGACATCTGAGGACTCTGCGGTCTATTACTGTCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGCATGATTCATCCTTCC......GATAGTGAAACTAGGTTAAATCAGAAGTTCAAG...GACAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCCGACATCTGAGGACTCTGCGGTCTATTACTGT
IGHV-CXK4 12022-05-14watson_et_al:LEWES_EiJ_IGHV2-5FLEWES/EiJCAAGTGCAGATGAAGGAGTCAGGACCTGACCTTGTGCAGCCATCACAGACTCTGTCTCTCACCTGCACTGTCTCTGGGTTCTCATTAAGTAGCTATGGTGTACATTGGTTTCGCAAGCCTCCGAGAAAGGGATTGGAATGGTTGGGAGGAATATGGTCTGGTGGAAGCATATACTATAATCCAGCTCTCAGTTCCCGACTGAGTGTCAGCAGGGACATCTCTAAGAGCCAAGTTTTCTTTAAAATGAGCAGTCTGCAAAGTGAAGACACGGCTGTGTACCACTGTGCCAAGTGCAGATGAAGGAGTCAGGACCT...GACCTTGTGCAGCCATCACAGACTCTGTCTCTCACCTGCACTGTCTCTGGGTTCTCATTA............AGTAGCTATGGTGTACATTGGTTTCGCAAGCCTCCGAGAAAGGGATTGGAATGGTTGGGAGGAATATGGTCTGGT.........GGAAGCATATACTATAATCCAGCTCTCAGT...TCCCGACTGAGTGTCAGCAGGGACATCTCTAAGAGCCAAGTTTTCTTTAAAATGAGCAGTCTGCAAAGTGAAGACACGGCTGTGTACCACTGTGC
IGHV-DDX4 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-12FLEWES/EiJGAGATCCAGCTGCAGCAGACTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTATTCATTCACTGACTACATCATGCTCTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAAATATTAATCCTTACTATGGTAGTACTAGCTACAATCAGAAGTTCAAGGGCAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGAGATCCAGCTGCAGCAGACTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGTTATTCATTC............ACTGACTACATCATGCTCTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAAATATTAATCCTTAC......TATGGTAGTACTAGCTACAATCAGAAGTTCAAG...GGCAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAA
IGHV-DSCL 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-15FLEWES/EiJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATAAACTGGGTGAAGCTGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGATATTTATCCTGGTAGTGGTAGTACTAACTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTC............ACCAGCTACTGGATAAACTGGGTGAAGCTGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGATATTTATCCTGGT......AGTGGTAGTACTAACTACAATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGC
IGHV-E7Q2 12022-05-14IGHV14-3*02|Mus_musculus_129/Svwatson_et_al:LEWES_EiJ_IGHV14-3FLEWES/EiJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAGACACCTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGCGAATGGTAATACTAAATATGACCCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAGACACCTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGATTGATCCTGCG......AATGGTAATACTAAATATGACCCGAAGTTCCAG...GGCAAGGCCACTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTG
IGHV-EM76 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-18FLEWES/EiJCAGGGTCAGATGCAGCAGTCTGGAGCTGAGTTGGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGACTTCTGGCTTCACCTTCAGCAGTAGCTATATAAGTTGGTTGAAGCAGAAGCCTGGACAGAGTCTTGAGTGGATTGCATGGATTTATCCTGGAAGTGGTAGTACTAGCTATAATCAGAAGTTCACGGGCAAGGCCCAACTGACTGCAGACACATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCCATCTATTACTGTGCAACAGGGTCAGATGCAGCAGTCTGGAGCT...GAGTTGGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGACTTCTGGCTTCACCTTC............AGCAGTAGCTATATAAGTTGGTTGAAGCAGAAGCCTGGACAGAGTCTTGAGTGGATTGCATGGATTTATCCTGGA......AGTGGTAGTACTAGCTATAATCAGAAGTTCACG...GGCAAGGCCCAACTGACTGCAGACACATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCCATCTATTACTGTGCAA
IGHV-ETE7 12022-05-14watson_et_al:LEWES_EiJ_IGHV10-1FLEWES/EiJGAGGTGCAGCTTGTTGAGTCTGGTGGAGGATTGGTGCAGCCTAAAGGGACATTGAAACTCTCATGTGCCGCCTCTGGATTCAGCTTCAATACCTATGCCATGAACTGGGTCCGCCAGGCTCCAGGAAAGAGTTTGGAATGGGTTGCTCGCACAATGAGTAAAAGTAATAATTATGCAACATATTATGCAGATTCAGTGAAAGACAGATTCACCATCTCCAGAGATGATTCACAAAGCATGCTCTATCTGCAAATGAACAACTTGAAAACTGAGGACACAGCCATGTATTACTGTGAGGTGCAGCTTGTTGAGTCTGGTGGA...GGATTGGTGCAGCCTAAAGGGACATTGAAACTCTCATGTGCCGCCTCTGGATTCAGCTTC............AATACCTATGCCATGAACTGGGTCCGCCAGGCTCCAGGAAAGAGTTTGGAATGGGTTGCTCGCACAATGAGTAAAAGTAATAATTATGCAACATATTATGCAGATTCAGTGAAA...GACAGATTCACCATCTCCAGAGATGATTCACAAAGCATGCTCTATCTGCAAATGAACAACTTGAAAACTGAGGACACAGCCATGTATTACTGT
IGHV-F77Z 12022-05-14watson_et_al:LEWES_EiJ_IGHV5-4FLEWES/EiJGAGGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCGGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTACGGAATGGTGTGGGTTCGACAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGCATACATTAGTAGTGGCAGTAGTACCATCTACTATGCAGACACAGTGAAGGGCCGATTCACCATCTCCAGAGACAATCCCAAGAACACCCTGTTCCTGCAAATGAGCAGTCTAAGGTCTGAGGACACGGCCATGTATTACTGTGCGAGGTGAAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGGGTCCCGGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTGACTACGGAATGGTGTGGGTTCGACAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGCATACATTAGTAGTGGC......AGTAGTACCATCTACTATGCAGACACAGTGAAG...GGCCGATTCACCATCTCCAGAGACAATCCCAAGAACACCCTGTTCCTGCAAATGAGCAGTCTAAGGTCTGAGGACACGGCCATGTATTACTGTGC
IGHV-FAVL 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-19FLEWES/EiJCAGGTTCAGCTGCAGCAGTCTGGAGCTGAACTGGTAAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGACTACACCTTCACAAGCTATGATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTGGAAGTGGTAATACTAAGTACAATGAGAAGTTTAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGATTCTGCGGTCTATTTCTGTGCCAGGTTCAGCTGCAGCAGTCTGGAGCT...GAACTGGTAAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGACTACACCTTC............ACAAGCTATGATATAAACTGGGTGAAGCAGAGGCCTGGACAGGGACTTGAGTGGATTGGATGGATTTATCCTGGA......AGTGGTAATACTAAGTACAATGAGAAGTTTAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGATTCTGCGGTCTATTTCTGTGC
IGHV-FN67 12022-05-14watson_et_al:LEWES_EiJ_IGHV5-1FLEWES/EiJGACGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGAAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCGCTTTCAGTAGCTATGGCATGGCTTGGGTTCGACAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAATGGTGGTGTTAGCACCTACTATCCAGACAATGTAAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTTTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTACAGACGTGAAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGAAGCCTGAAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCGCTTTC............AGTAGCTATGGCATGGCTTGGGTTCGACAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAATGGT......GGTGTTAGCACCTACTATCCAGACAATGTAAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTTTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTACA
IGHV-GHCM 12022-05-14watson_et_al:LEWES_EiJ_IGHV10-3FLEWES/EiJGAGGTGCAGCTTGTTGAGTCTGGTGGAGGATTGGTGCAGCCTAAAGGATCATTGAAACTCTCATGTGCCACCTCTGGATTCACCTTCAATACCTATGCCATGCACTGGGTCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTTACAATTATGCAACATATTATGCCGATTCAGTGAAAGACAGATTCACCATCTCCAGAGATGATTCACAAAGCATGCTCTATCTGCAAATGAACAACCTGAAAACTGAGGACACAGCCATGTATTACTGTGAGGTGCAGCTTGTTGAGTCTGGTGGA...GGATTGGTGCAGCCTAAAGGATCATTGAAACTCTCATGTGCCACCTCTGGATTCACCTTC............AATACCTATGCCATGCACTGGGTCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTTACAATTATGCAACATATTATGCCGATTCAGTGAAA...GACAGATTCACCATCTCCAGAGATGATTCACAAAGCATGCTCTATCTGCAAATGAACAACCTGAAAACTGAGGACACAGCCATGTATTACTGT
IGHV-GNOX 12022-05-14IGHV5-15*02|Mus_musculus_129/Svwatson_et_al:LEWES_EiJ_IGHV5-3FLEWES/EiJGAGGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGTCCCGGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTACGGAATGGCGTGGGTTCGACAGGCTCCAGGGAAGGGGCCTGAGTGGGTAGCATTCATTAGTAATTTGGCATATAGTATCTACTATGCAGACACTGTGACGGGCCGATTCACCATCTCTAGAGAGAATGCCAAGAACACCCTGTACCTGGAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATGTACTACTGTGCAAGGAGGTGAAGCTGGTGGAGTCTGGGGGA...GGCTTAGTGCAGCCTGGAGGGTCCCGGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTGACTACGGAATGGCGTGGGTTCGACAGGCTCCAGGGAAGGGGCCTGAGTGGGTAGCATTCATTAGTAATTTG......GCATATAGTATCTACTATGCAGACACTGTGACG...GGCCGATTCACCATCTCTAGAGAGAATGCCAAGAACACCCTGTACCTGGAAATGAGCAGTCTGAGGTCTGAGGACACAGCCATGTACTACTGTGCAAG
IGHV-H6VA 12022-05-14IGHV14-4*02|Mus_musculus_129/Svwatson_et_al:LEWES_EiJ_IGHV14-4FLEWES/EiJGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAGGTCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAAAGACTACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAGAATGGTGATACTGAATATGCCCCGAAGTTCCAGGGCAAGGCCACTATGACTGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGAGGTTCAGCTGCAGCAGTCTGGGGCA...GAGCTTGTGAGGTCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATT............AAAGACTACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAG......AATGGTGATACTGAATATGCCCCGAAGTTCCAG...GGCAAGGCCACTATGACTGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGT
IGHV-HAGV 12022-05-14watson_et_al:LEWES_EiJ_IGHV5-5FLEWES/EiJGACGTGAAGCTCGTGGAGTCTGGGGGAGGCTTAGTGAAGCTTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATTACATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAGAAATTAGTAATAGTGGTGGTAACACCTACTATCCAGACACTGTGAAGGGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAATTCTGAGGACACAGCCGTGTATTACTGTGGACGTGAAGCTCGTGGAGTCTGGGGGA...GGCTTAGTGAAGCTTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAGCTATTACATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAGAAATTAGTAATAGT......GGTGGTAACACCTACTATCCAGACACTGTGAAG...GGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAATTCTGAGGACACAGCCGTGTATTACTGTG
IGHV-HWYE 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-3FLEWES/EiJCAGGTTCAACTGCAGCAGTCTGGAGCTGAGCTGGTGAGGCCTGGGGCTTCAGTGACGCTGTCCTGCAAGGCTTCGGGCTACACATTTACTGACTATGAAATGCACTGGGTGAAGCAGACACCTGTGCATGGCCTGGAATGGATTGGAGCTATTGATCCTGAAACTGGTGATACTGCCTACAATCAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGACATCTGAGGACTCTGCCGTCTATTACTGTCAGGTTCAACTGCAGCAGTCTGGAGCT...GAGCTGGTGAGGCCTGGGGCTTCAGTGACGCTGTCCTGCAAGGCTTCGGGCTACACATTT............ACTGACTATGAAATGCACTGGGTGAAGCAGACACCTGTGCATGGCCTGGAATGGATTGGAGCTATTGATCCTGAA......ACTGGTGATACTGCCTACAATCAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGACATCTGAGGACTCTGCCGTCTATTACTGT
IGHV-IT4O 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-26FLEWES/EiJCAGGTCCAGCTACAGCAGTCTGGGGCTGAACTGGTGAAGCCTGGGGCCTCAGTTAAGATTTCCTGCAAAGCTTCTGGCTACGCATTCAGTAGCTCCTGGATGAACTGGGTGAAGCAGAGGCCTGGAAAGGGTCTTGAGTGGATTGGACAGATTTATCCTGGAGATGGTGATACTAACTACAATGGAAAGTTCAAGGGTAAAGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGCCAGGTCCAGCTACAGCAGTCTGGGGCT...GAACTGGTGAAGCCTGGGGCCTCAGTTAAGATTTCCTGCAAAGCTTCTGGCTACGCATTC............AGTAGCTCCTGGATGAACTGGGTGAAGCAGAGGCCTGGAAAGGGTCTTGAGTGGATTGGACAGATTTATCCTGGA......GATGGTGATACTAACTACAATGGAAAGTTCAAG...GGTAAAGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTTCTGTGC
IGHV-ITQ5 12022-05-14IGHV7-3*02|Mus_musculus_129/Svwatson_et_al:LEWES_EiJ_IGHV7-3FLEWES/EiJGAGGTGAAGCTGGTGGAGTCTGGAGGAGGCTTGGTACAGCCTGGGGGTTCTCTGAGACTCTCCTGTGCAACTTCTGGGTTCACCTTCACTGATTACTACATGAGCTGGGTCCGCCAGCCTCCAGGAAAGGCACTTGAGTGGTTGGGTTTTATTAGAAACAAAGCTAATGGTTACACAACAGAGTACAGTGCATCTGTGAAGGGTCGGTTCACCATCTCCAGAGATAATTCCCAAAGCATCCTCTATCTTCAAATGAACACCCTGAGAGCTGAGGACAGTGCCACTTATTACTGTGCGAGGTGAAGCTGGTGGAGTCTGGAGGA...GGCTTGGTACAGCCTGGGGGTTCTCTGAGACTCTCCTGTGCAACTTCTGGGTTCACCTTC............ACTGATTACTACATGAGCTGGGTCCGCCAGCCTCCAGGAAAGGCACTTGAGTGGTTGGGTTTTATTAGAAACAAAGCTAATGGTTACACAACAGAGTACAGTGCATCTGTGAAG...GGTCGGTTCACCATCTCCAGAGATAATTCCCAAAGCATCCTCTATCTTCAAATGAACACCCTGAGAGCTGAGGACAGTGCCACTTATTACTGTGC
IGHV-JAWA 12022-05-14watson_et_al:LEWES_EiJ_IGHV12-2FLEWES/EiJCAGATGCAGCTTCAGGAGTCAGGACCTGGCCTGGTGAAACCCTCACAGTCACTCTTCCTCGCCTGCTCTATTACTGGTTTCCCCATCACCAGTGGTTACTACTGGATCTGGATCCGTCAGTCACCTGGGAAACCCCTAGAATGGATGGGGTACATCACTCATAGTGGGGAAACATTCTACAACCCATCCCTCCAGAGCCCCATCTCCATTACTAGAGAAACATCCAAGAACCAGTTCTTTCTGCAATTGAACTCTGTGACCACAGAGGACACAGCCATGTATTACTGTGCAGGAGACCAGATGCAGCTTCAGGAGTCAGGACCT...GGCCTGGTGAAACCCTCACAGTCACTCTTCCTCGCCTGCTCTATTACTGGTTTCCCCATCACC.........AGTGGTTACTACTGGATCTGGATCCGTCAGTCACCTGGGAAACCCCTAGAATGGATGGGGTACATCACTCATAGT.........GGGGAAACATTCTACAACCCATCCCTCCAG...AGCCCCATCTCCATTACTAGAGAAACATCCAAGAACCAGTTCTTTCTGCAATTGAACTCTGTGACCACAGAGGACACAGCCATGTATTACTGTGCAGGAGAC
IGHV-JQQ7 12022-05-14IGHV4-1*02|Mus_musculus_129/Svwatson_et_al:LEWES_EiJ_IGHV4-1FLEWES/EiJGAGGTGAAGCTTCTCGAGTCTGGAGGTGGCCTGGTGCAGCCTGGAGGATCCCTGAAACTCTCCTGTGCAGCCTCAGGATTCGATTTTAGTAGATACTGGATGAGTTGGGTCCGGCAGGCTCCAGGGAAAGGGCTAGAATGGATTGGAGAAATTAATCCAGATAGCAGTACGATAAACTATACGCCATCTCTAAAGGATAAATTCATCATCTCCAGAGACAACGCCAAAAATACGCTGTACCTGCAAATGAGCAAAGTGAGATCTGAGGACACAGCCCTTTATTACTGTGAGGTGAAGCTTCTCGAGTCTGGAGGT...GGCCTGGTGCAGCCTGGAGGATCCCTGAAACTCTCCTGTGCAGCCTCAGGATTCGATTTT............AGTAGATACTGGATGAGTTGGGTCCGGCAGGCTCCAGGGAAAGGGCTAGAATGGATTGGAGAAATTAATCCAGAT......AGCAGTACGATAAACTATACGCCATCTCTAAAG...GATAAATTCATCATCTCCAGAGACAACGCCAAAAATACGCTGTACCTGCAAATGAGCAAAGTGAGATCTGAGGACACAGCCCTTTATTACTGT
IGHV-LEBH 12022-05-14IGHV1-87*01|Mus_musculuswatson_et_al:LEWES_EiJ_IGHV1-29FLEWES/EiJCAGGTTCAGCTCCAGCAGTCTGGGGCTGAGCTGGCAAGACCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTTACCAGCTACTGGATGCAGTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGGGCTATTTATCCTGGAGATGGTGATACTAGGTACACTCAGAAGTTCAAGGGCAGGGCCACATTGACTGCAGATAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCTTGACATCTGAGGACTCTGCGGTCTATTACTGTGCCAGGTTCAGCTCCAGCAGTCTGGGGCT...GAGCTGGCAAGACCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTT............ACCAGCTACTGGATGCAGTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGGGCTATTTATCCTGGA......GATGGTGATACTAGGTACACTCAGAAGTTCAAG...GGCAGGGCCACATTGACTGCAGATAAATCCTCCAGCACAGCCTACATGCAACTCAGCAGCTTGACATCTGAGGACTCTGCGGTCTATTACTGTGC
IGHV-LUAR 12022-05-14IGHV4-2*02|Mus_musculus_129/Svwatson_et_al:LEWES_EiJ_IGHV4-3FLEWES/EiJGAGGTGAAGCTTCTCGAGTCTGGAGGTGGCCTGGTGCAGCCTGGAGGATCCCTGAATCTCTCCTGTGCAGCCTCAGGATTCGATTTTAGTAGATACTGGATGAGTTGGGCTCGGCAGGCTCCAGGGAAAGGGCAGGAATGGATTGGAGAAATTAATCCAGGAAGCAGTACGATAAACTATACGCCATCTCTAAAGGATAAATTCATCATCTCCAGAGACAACGCCAAAAATACGCTGTACCTGCAAATGAGCAAAGTGAGATCTGAGGACACAGCCCTTTATTACTGTGGAGGTGAAGCTTCTCGAGTCTGGAGGT...GGCCTGGTGCAGCCTGGAGGATCCCTGAATCTCTCCTGTGCAGCCTCAGGATTCGATTTT............AGTAGATACTGGATGAGTTGGGCTCGGCAGGCTCCAGGGAAAGGGCAGGAATGGATTGGAGAAATTAATCCAGGA......AGCAGTACGATAAACTATACGCCATCTCTAAAG...GATAAATTCATCATCTCCAGAGACAACGCCAAAAATACGCTGTACCTGCAAATGAGCAAAGTGAGATCTGAGGACACAGCCCTTTATTACTGTG
IGHV-LXLP 12022-05-14watson_et_al:LEWES_EiJ_IGHV8-4FLEWES/EiJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTCTGGTATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGAATGATGTCAAGCCCTATAACCCAGCCCTGAAGAGCCGACTGACTATCTCCAAGGATACCTCCAGCAGCCAGGTATTCCTCAAGATCGCCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCGAATCAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTCTGGTATGGGTGTAGGCTGGATTCGTCAGCCTTCAGGGAAGGGTCTGGAGTGGCTGGCACACATTTGGTGGAAT.........GATGTCAAGCCCTATAACCCAGCCCTGAAG...AGCCGACTGACTATCTCCAAGGATACCTCCAGCAGCCAGGTATTCCTCAAGATCGCCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCGAAT
IGHV-MJAE 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-10FLEWES/EiJGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTCACTGACTACAACATGCACTGGGTGAAGCATGGAAAGAGCCTTGAGTGGATTGGATATATTTATCCTAACAATGGTGGTACTGGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCGAGGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACAACATGCACTGGGTGAAGCATGGAAAGAGCCTTGAGTGGATTGGATATATTTATCCTAACAATGGT......GGTACTGGCTACAACCAGAAGTTCAAGGGCAAG...GCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGC
IGHV-MM6D 12022-05-14IGHV3-1*02|Mus_musculus_129/Svwatson_et_al:LEWES_EiJ_IGHV3-1FLEWES/EiJGATGTGCAGCTTCAGGAGTCAGGACCTGACCTGGTGAAACCTTCTCAGTCACTTTCACTCACCTGCACTGTCACTGGCTACTCCATCACCAGTGGTTATAGCTGGCACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAATGGATGGGCTACATACACTACAGTGGTAGCACTAACTACAACCCATCTCTCAAAAGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTTCCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGATGTGCAGCTTCAGGAGTCAGGACCT...GACCTGGTGAAACCTTCTCAGTCACTTTCACTCACCTGCACTGTCACTGGCTACTCCATCACC.........AGTGGTTATAGCTGGCACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAATGGATGGGCTACATACACTACAGT.........GGTAGCACTAACTACAACCCATCTCTCAAA...AGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTTCCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGT
IGHV-MQX7 12022-05-14IGHV2-2*01|Mus_musculus_C57BL/6watson_et_al:LEWES_EiJ_IGHV2-2FLEWES/EiJCAGGTGCAGCTGAAGCAGTCAGGACCTGGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTAACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGTGGAAGCACAGACTATAATGCAGCTTTCATATCCAGACTGAGCATCAGCAAGGACAATTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATATTACTGTCAGGTGCAGCTGAAGCAGTCAGGACCT...GGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTA............ACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGT.........GGAAGCACAGACTATAATGCAGCTTTCATA...TCCAGACTGAGCATCAGCAAGGACAATTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATATTACTGT
IGHV-MYOQ 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-34FLEWES/EiJCAGGTCCAACTGCAGCAGCCTGGGTCTGTGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACATTCACCAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGGGATTTATCCTAATAGTGGTAGTACTGACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGGATCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAGGTCCAACTGCAGCAGCCTGGGTCT...GTGCTGGTGAGGCCTGGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACATTC............ACCAGCTACTGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGGGATTTATCCTAAT......AGTGGTAGTACTGACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGGATCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTG
IGHV-N4LP 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-21FLEWES/EiJCAGGTCCAGCTGCAGCAGTCTGGCGCTGAACTGGCAAAACCTGGGACCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTTACTAGCTACTGGATGAACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGGGCTATTAATCCTAGCAATGGTTATACTGAGTACAATCAGAAGTTCAAGGACAAGGCCATATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTGAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTCAGGTCCAGCTGCAGCAGTCTGGCGCT...GAACTGGCAAAACCTGGGACCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTT............ACTAGCTACTGGATGAACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGGGCTATTAATCCTAGC......AATGGTTATACTGAGTACAATCAGAAGTTCAAG...GACAAGGCCATATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTGAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGT
IGHV-NJZ4 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-7FLEWES/EiJGAGGTCCAGCTGCAACAGTCTGGACCTGACCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTCACTGACTACGACATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTTATCCTAACAATGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGATTCTGCAGTCTATTACTGTGCGAGGTCCAGCTGCAACAGTCTGGACCT...GACCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACGACATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTTATCCTAAC......AATGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGATTCTGCAGTCTATTACTGTGC
IGHV-NROW 12022-05-14watson_et_al:LEWES_EiJ_IGHV3-2FLEWES/EiJGATGTGCAGCTTCAGGAGTCGGGACCTGGCCTGGTGAAACCTTCTCAGTCTCTGTCCCTCACCTGCACTGTCACTGGCTACTCAATCACCAGTGGTTATGCCTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAATCTACAGTGGTAGCACTAACTACAACCCATCTCTCAAAAGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTTCCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCAAGATGTGCAGCTTCAGGAGTCGGGACCT...GGCCTGGTGAAACCTTCTCAGTCTCTGTCCCTCACCTGCACTGTCACTGGCTACTCAATCACC.........AGTGGTTATGCCTGGAACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAATCTACAGT.........GGTAGCACTAACTACAACCCATCTCTCAAA...AGTCGAATCTCTATCACTCGAGACACATCCAAGAACCAGTTCTTCCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCAA
IGHV-NZDB 12022-05-14IGHV9-2-1*01|Mus_musculus_129/Svwatson_et_al:LEWES_EiJ_IGHV9-2FLEWES/EiJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGTTATACCTTCACAGACTATTCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACTGAGACTGGTGAGCCAACATATGCAGATGACTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGTTATACCTTC............ACAGACTATTCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACTGAG......ACTGGTGAGCCAACATATGCAGATGACTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTG
IGHV-O7TX 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-4FLEWES/EiJGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTCACTGACTACACCATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACTTGTTAATCCTAACAATGGTGGTACTAACTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTTCTGTCTATTACTGTGCAAGAGGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACACCATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACTTGTTAATCCTAAC......AATGGTGGTACTAACTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTTCTGTCTATTACTGTGCAA
IGHV-OV7N 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-11FLEWES/EiJGAGGTTCAGCTGCAGCAGTCTGGACCTGACCTGGTGAAGCCTGGGGATTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTTACTGGCTACTTTATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACGTATTAATCCTTACAATGGTGTTACTTTCTACAACCAGAAGTTCAAAGGCAAGGCCACATTGACTGTAGACAAATCCTCTAGCACAGCCCACATGGAGCTCCTGAGCCTGACATCTGAGGACTTTGCAGTCTATTATTGTGCAAGAGGTTCAGCTGCAGCAGTCTGGACCT...GACCTGGTGAAGCCTGGGGATTCAGTGAAGATATCCTGCAAGGCTTCTGGTTACTCATTT............ACTGGCTACTTTATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGACGTATTAATCCTTAC......AATGGTGTTACTTTCTACAACCAGAAGTTCAAA...GGCAAGGCCACATTGACTGTAGACAAATCCTCTAGCACAGCCCACATGGAGCTCCTGAGCCTGACATCTGAGGACTTTGCAGTCTATTATTGTGCAA
IGHV-P2SD 12022-05-14watson_et_al:LEWES_EiJ_IGHV9-1FLEWES/EiJCAGATCCATTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCCAGGCTTCTGGGTATACCTTCACAGGCTATTCAATGCACTGGGTGAAGCAGGCTCCAAGAAAGGGTTTAAAGTGGATGGGCTTGATATACACCAACACTGGAGAGCCAACATATGATGAAGAGTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGCAGATCCATTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCCAGGCTTCTGGGTATACCTTC............ACAGGCTATTCAATGCACTGGGTGAAGCAGGCTCCAAGAAAGGGTTTAAAGTGGATGGGCTTGATATACACCAAC......ACTGGAGAGCCAACATATGATGAAGAGTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTG
IGHV-PCMZ 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-6FLEWES/EiJGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGCTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTCACTGACTACACCATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGGTATTAATCCTAACAATGGTGGTACTAGCTACAACGAGAAGTTCAAGGGCAAGGCCACCTTGACTGTAGACAAGTCCTCAAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGATTCTGCAGTCTATTACTGTGCAAGGAGGTCCAGCTGCAACAGTCTGGACCT...GAGCTGCTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACACCATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGGTATTAATCCTAAC......AATGGTGGTACTAGCTACAACGAGAAGTTCAAG...GGCAAGGCCACCTTGACTGTAGACAAGTCCTCAAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGATTCTGCAGTCTATTACTGTGCAAG
IGHV-PSQP 12022-05-14watson_et_al:LEWES_EiJ_IGHV7-2FLEWES/EiJGAGGTGAAGCTGGTGGAGTCTGGAGGAGGCTTGGTACAGCCTGGGGCTTCTCTGAGACTCTCCTGTGCAACTTCTGGATTCACCTTCACTGATTACTACATGAACTGGGTCCGCCAGCCTCCAGGGAAGGCACTTGAGTGGTTGGGTTTTATTAGAAACAAAGCTAATGGTTACACAACAGAGTACAGTGCATCTGTGAAGGGTCGGTTCACCATCTCCAGAGATAATTCCCAAAGCATCCTCTATCTTCAAATGAACACACTGAGAGCTGAGGACAGTGCCACTTATTACTGTGCGAGGTGAAGCTGGTGGAGTCTGGAGGA...GGCTTGGTACAGCCTGGGGCTTCTCTGAGACTCTCCTGTGCAACTTCTGGATTCACCTTC............ACTGATTACTACATGAACTGGGTCCGCCAGCCTCCAGGGAAGGCACTTGAGTGGTTGGGTTTTATTAGAAACAAAGCTAATGGTTACACAACAGAGTACAGTGCATCTGTGAAG...GGTCGGTTCACCATCTCCAGAGATAATTCCCAAAGCATCCTCTATCTTCAAATGAACACACTGAGAGCTGAGGACAGTGCCACTTATTACTGTGC
IGHV-PUSX 12022-05-14IGHV1S45*01|Mus_musculus_I/Stwatson_et_al:LEWES_EiJ_IGHV1-33FLEWES/EiJGAAGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTGACTATGTTATGCACTGGGTGAAGCAGAGCAATGGAAAGAGCCTTGAGTGGATTGGATATATTAATCCTTATAATGATTATACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGAGAAGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTC............ACTGACTATGTTATGCACTGGGTGAAGCAGAGCAATGGAAAGAGCCTTGAGTGGATTGGATATATTAATCCTTAT......AATGATTATACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGA
IGHV-PZT4 12022-05-14watson_et_al:LEWES_EiJ_IGHV2-1FLEWES/EiJCAGGTGCAGATGAAGCAGTCAGGACCTGGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTAACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGTGGAAGCACAGACTATAATGCAGCTTTCATTTCCAGACTGAGCATCAGCAAGGACAATTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATACTACTGTGTCCAGGTGCAGATGAAGCAGTCAGGACCT...GGCCTAGTGCAGCCCTCACAGAGCCTGTCCATCACCTGCACAGTCTCTGGTTTCTCATTA............ACTAGCTATGGTGTACACTGGGTTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGAGTGGT.........GGAAGCACAGACTATAATGCAGCTTTCATT...TCCAGACTGAGCATCAGCAAGGACAATTCCAAGAGCCAAGTTTTCTTTAAAATGAACAGTCTGCAAGCTGATGACACAGCCATATACTACTGTGTC
IGHV-Q4FB 12022-05-14watson_et_al:LEWES_EiJ_IGHV3-4FLEWES/EiJGATGTACAGCTTCAGGAGTCAGGACCTGGCCTCGTGAAACCTTCTCAGTCTCTGTCTCTCACCTGCTCTGTCACTGGCTACTCCATCACCAGTGATTATTACTGGCACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTATGATGGTAGCAATAACTACAACCCATCTCTCAAAAATCGAATCTCCATCACTCGTGACACATCTAAGAATCAGTTCTTCCTGAAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCGATGTACAGCTTCAGGAGTCAGGACCT...GGCCTCGTGAAACCTTCTCAGTCTCTGTCTCTCACCTGCTCTGTCACTGGCTACTCCATCACC.........AGTGATTATTACTGGCACTGGATCCGGCAGTTTCCAGGAAACAAACTGGAGTGGATGGGCTACATAAGCTATGAT.........GGTAGCAATAACTACAACCCATCTCTCAAA...AATCGAATCTCCATCACTCGTGACACATCTAAGAATCAGTTCTTCCTGAAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGC
IGHV-Q55D 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-24FLEWES/EiJCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTGGTGAGGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTAGCTACACGTTCACCCGCTACTGGATGAACTGGGTTAAGCAGAGGCCTGAGCAAGGCCTTGAGTGGATTGGAAGGATTGATCCTTACGATAGTGAAACTCACTACAATCAAAAGTTCAAGGACAAGGCCATATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCACCCTGACATCTGAGGACTCTGCGGTCTATTACTGTCAGGTCCAACTGCAGCAGCCTGGGGCT...GAGCTGGTGAGGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTAGCTACACGTTC............ACCCGCTACTGGATGAACTGGGTTAAGCAGAGGCCTGAGCAAGGCCTTGAGTGGATTGGAAGGATTGATCCTTAC......GATAGTGAAACTCACTACAATCAAAAGTTCAAG...GACAAGGCCATATTGACTGTAGACAAATCCTCCAGCACAGCCTACATGCAACTCAGCACCCTGACATCTGAGGACTCTGCGGTCTATTACTGT
IGHV-QECB 12022-05-14IGHV14-1*02|Mus_musculus_129/Svwatson_et_al:LEWES_EiJ_IGHV14-2FLEWES/EiJGAGGTTCAGCTGCAGCAGTCTGGGGCTGAGCTTGTGAGGCCAGGGGCCTTAGTCAAGTTGTCCTGCAAAGCTTCTGGCTTCAACATTAAAGACTACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAGAATGGTAATACTATATATGACCCGAAGTTCCAGGGCAAGGCCAGTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGGAGGTTCAGCTGCAGCAGTCTGGGGCT...GAGCTTGTGAGGCCAGGGGCCTTAGTCAAGTTGTCCTGCAAAGCTTCTGGCTTCAACATT............AAAGACTACTATATGCACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAG......AATGGTAATACTATATATGACCCGAAGTTCCAG...GGCAAGGCCAGTATAACAGCAGACACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTG
IGHV-QRAR 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-5FLEWES/EiJGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGTCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTCACTGACTACAGCATGGACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGCTATTAATCCTAACAATGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGAGGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGTCTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACAGCATGGACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGCTATTAATCCTAAC......AATGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGGAGCTCCACAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGT
IGHV-QU7Q 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-27FLEWES/EiJCAGGTTCAGCTGCAGCAGTCTGGAGCTGAGCTGGCGAGGCCCGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGATACACCTTCACAAGCTATGGTATAAGCTGGGTGAAGCAGAGAACTGGACAGGGCCTTGAGTGGATTGGAGAGATTTTTCCTGGAAGTGGTAATACTTACTACAATGAGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCAACAGGTTCAGCTGCAGCAGTCTGGAGCT...GAGCTGGCGAGGCCCGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGATACACCTTC............ACAAGCTATGGTATAAGCTGGGTGAAGCAGAGAACTGGACAGGGCCTTGAGTGGATTGGAGAGATTTTTCCTGGA......AGTGGTAATACTTACTACAATGAGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTTCTGTGCAA
IGHV-QZGM 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-32FLEWES/EiJGAGATCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTGACTACTACATGCACTGGGTGAAGCAGAGCAATGGAAAGAGCCTTGAGTGGATTGGATATATTAATCCTTATAATGATTATACTAGCTACAACCAGAAGTTCAATGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCATTCTATTACTGTGCAGAGATCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTC............ACTGACTACTACATGCACTGGGTGAAGCAGAGCAATGGAAAGAGCCTTGAGTGGATTGGATATATTAATCCTTAT......AATGATTATACTAGCTACAACCAGAAGTTCAAT...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGCCTACATGCAGCTCAACAGCCTGACATCTGAGGACTCTGCATTCTATTACTGTGCA
IGHV-RAAJ 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-9FLEWES/EiJGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGTCTTCAGTGAAGATATCATGTAAGGCTTCTGGATACACATTCACTGACTACTACATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTATCAATGGTGGTACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGACTACATGGAGCTCCGCGGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGGAGGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGTCTTCAGTGAAGATATCATGTAAGGCTTCTGGATACACATTC............ACTGACTACTACATGAACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTATC......AATGGTGGTACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGCACAGACTACATGGAGCTCCGCGGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAG
IGHV-RG5I 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-28FLEWES/EiJCAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAAGCTTCTGGCTACGCATTCAGTAGCTCTTGGATGAACTGGGTGAAGCAGAGGCCTGGACAGGGTCTTGAGTGGATTGGACGGATTTATCCTGGAGATGGAGATACTAACTACAATGGGAAGTTCAAGGGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACCTCTGTGGACTCTGCGGTCTATTTCTGTGCCAGGTCCAGCTGCAGCAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATTTCCTGCAAAGCTTCTGGCTACGCATTC............AGTAGCTCTTGGATGAACTGGGTGAAGCAGAGGCCTGGACAGGGTCTTGAGTGGATTGGACGGATTTATCCTGGA......GATGGAGATACTAACTACAATGGGAAGTTCAAG...GGCAAGGCCACACTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACCTCTGTGGACTCTGCGGTCTATTTCTGTGC
IGHV-RMID 12022-05-14watson_et_al:LEWES_EiJ_IGHV9-3FLEWES/EiJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAGACTATTCAATGCACTGGGTGAAGCAGGCTCCAAGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCAAGACTGGTGTGCCAACATATGCTGAAGAGTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGCCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACAGACTATTCAATGCACTGGGTGAAGCAGGCTCCAAGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCAAG......ACTGGTGTGCCAACATATGCTGAAGAGTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACATGGCTACATATTTCTGTGC
IGHV-S4M5 12022-05-14watson_et_al:LEWES_EiJ_IGHV8-2FLEWES/EiJCAGGTTACTCTGAAAGAGTCTGGCCCTGGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGCACTTCTGGTATGGGTGTGAGCTGGATTCGTCAGCCTTCAGGAAAGGGTCTGGAGTGGCTGGCACACATTTACTGGGATGATGACAAGCGCTATAACCCATCCCTGAAGAGCCGGCTCACAATCTCCAAGGATACCTCCAGCAACCAAGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCGCAGGTTACTCTGAAAGAGTCTGGCCCT...GGGATATTGCAGCCCTCCCAGACCCTCAGTCTGACTTGTTCTTTCTCTGGGTTTTCACTGAGC......ACTTCTGGTATGGGTGTGAGCTGGATTCGTCAGCCTTCAGGAAAGGGTCTGGAGTGGCTGGCACACATTTACTGGGAT.........GATGACAAGCGCTATAACCCATCCCTGAAG...AGCCGGCTCACAATCTCCAAGGATACCTCCAGCAACCAAGTATTCCTCAAGATCACCAGTGTGGACACTGCAGATACTGCCACATACTACTGTGCTCG
IGHV-S6NR 12022-05-14watson_et_al:LEWES_EiJ_IGHV9-5FLEWES/EiJCAGATCCAGTTCGTGCAGTCTGGATCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTTACAAACTATCCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGCTTTCAAGTGGATGGGCTGGATAAACACCAACACTGGAGAGCCAACATATGCTGATGACTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACAGCTACATATTTCTGTGCCAGATCCAGTTCGTGCAGTCTGGATCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTT............ACAAACTATCCAATGCACTGGGTGAAGCAGGCTCCAGGAAAGGCTTTCAAGTGGATGGGCTGGATAAACACCAAC......ACTGGAGAGCCAACATATGCTGATGACTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACAGCTACATATTTCTGTGC
IGHV-SHHV 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-31FLEWES/EiJCAGGTCCAACTGCAGCAACCTGGGTCTGAGCTGGTGAGGCCTGGAGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACATTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTTATCCTGGTAGTGGTAGTAATAACTACGATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTACCAGGTCCAACTGCAGCAACCTGGGTCT...GAGCTGGTGAGGCCTGGAGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACATTC............ACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAAATATTTATCCTGGT......AGTGGTAGTAATAACTACGATGAGAAGTTCAAG...AGCAAGGCCACACTGACTGTAGACACATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTAC
IGHV-SPOH 12022-05-14watson_et_al:LEWES_EiJ_IGHV2-7FLEWES/EiJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTTCATCACATGCACCGTCTCAGGGTTCTCATTAACCAGCTATGAAATAAACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGACTGGTGGAAGCACAAATTATAATTCAGCTCTCATATCCAGACTGAGCATCAGCAAAGAAAACTCCAAGAGCCTAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATATATTACTGTGTAAGCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTTCATCACATGCACCGTCTCAGGGTTCTCATTA............ACCAGCTATGAAATAAACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGACTGGT.........GGAAGCACAAATTATAATTCAGCTCTCATA...TCCAGACTGAGCATCAGCAAAGAAAACTCCAAGAGCCTAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATATATTACTGTGTAAG
IGHV-TKIN 12022-05-14IGHV9-3-1*01|Mus_musculus_129/Svwatson_et_al:LEWES_EiJ_IGHV9-6FLEWES/EiJCAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCACAAACTATGGAATGAACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCTACACTGGAGAGCCAACATATGCTGATGACTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGCCAGATCCAGTTGGTGCAGTCTGGACCT...GAGCTGAAGAAGCCTGGAGAGACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTC............ACAAACTATGGAATGAACTGGGTGAAGCAGGCTCCAGGAAAGGGTTTAAAGTGGATGGGCTGGATAAACACCTAC......ACTGGAGAGCCAACATATGCTGATGACTTCAAG...GGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTGC
IGHV-UDU2 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-8FLEWES/EiJGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTAACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTTATCCTAACAATGGTGATACTAGCTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGTACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGATTCTGCAGTCTATTACTGTGGAGGTCCAGCTGCAACAGTCTGGACCT...GAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTC............ACTAACTACTACATGCACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGATATATTTATCCTAAC......AATGGTGATACTAGCTACAACCAGAAGTTCAAG...GGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGTACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGATTCTGCAGTCTATTACTGTG
IGHV-UIIH 12022-05-14watson_et_al:LEWES_EiJ_IGHV2-6FLEWES/EiJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACTTGCACTGTCTCTGGGTTTTCATTAACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGCTGGTGGAAGCACAAATTATAATTCGGCTCTCATATCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCCCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACTTGCACTGTCTCTGGGTTTTCATTA............ACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGCTGGT.........GGAAGCACAAATTATAATTCGGCTCTCATA...TCCAGACTGAGCATCAGCAAAGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATGTACTACTGTGCC
IGHV-V7DR 12022-05-14watson_et_al:LEWES_EiJ_IGHV2-3FLEWES/EiJCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCAGGGTTCTCATTAACCGACTATGGTGTAAGCTGGATTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTTGGAGTAATATGGGGTGGTGGAAGCACAAACTATAATTCAGCTCTCAAATCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCAGGTACTACTGTGCAGGTGCAGCTGAAGGAGTCAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACTGTCTCAGGGTTCTCATTA............ACCGACTATGGTGTAAGCTGGATTCGCCAGTCTCCAGGAAAGGGTCTGGAGTGGCTTGGAGTAATATGGGGTGGT.........GGAAGCACAAACTATAATTCAGCTCTCAAA...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCAGGTACTACTGTG
IGHV-VEZX 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-23FLEWES/EiJCAGGTCCAGCTGCAGCAGTCTGGGGCTGAACTGGCAAAACCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTTACTAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGCAGTGGTTATACTAAGTACAATCAGAAGTTCAAGGACAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTGAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGCAGGTCCAGCTGCAGCAGTCTGGGGCT...GAACTGGCAAAACCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTT............ACTAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGC......AGTGGTTATACTAAGTACAATCAGAAGTTCAAG...GACAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTGAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAG
IGHV-VPTU 12022-05-14watson_et_al:LEWES_EiJ_IGHV10-2FLEWES/EiJGAGGTGCAGCTTGTTGAGTCTGGTGGAAGATTGGTGCAGCCTAAAGGGTCATTGAAACTCTCATGTGCAGCCTCTGGATTCACCTTCAATACCTATGCCATGTACTGGATCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTAATAATTATGCAACATATTATGCCGATTCAGTGAAAGACAGATTCACCATCTCCAGAGATGATTCACAAAGCATGCTCTATCTGCAAATGAACAACCTGAAAACTGAGGACACAGCCATGTATTACTGTGAGGTGCAGCTTGTTGAGTCTGGTGGA...AGATTGGTGCAGCCTAAAGGGTCATTGAAACTCTCATGTGCAGCCTCTGGATTCACCTTC............AATACCTATGCCATGTACTGGATCCGCCAGGCTCCAGGAAAGGGTTTGGAATGGGTTGCTCGCATAAGAAGTAAAAGTAATAATTATGCAACATATTATGCCGATTCAGTGAAA...GACAGATTCACCATCTCCAGAGATGATTCACAAAGCATGCTCTATCTGCAAATGAACAACCTGAAAACTGAGGACACAGCCATGTATTACTGT
IGHV-VRBM 12022-05-14watson_et_al:LEWES_EiJ_IGHV1-22FLEWES/EiJCAGGTCCAGCTGCAGCAGTCTGGGGCTGAACTGGCAAAACCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTTACTAGCCACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGCAGTGGTCATACTGGGTACAATCAGAAGTTCAAGGACAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTGAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGACAGGTCCAGCTGCAGCAGTCTGGGGCT...GAACTGGCAAAACCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTT............ACTAGCCACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGC......AGTGGTCATACTGGGTACAATCAGAAGTTCAAG...GACAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTGAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGA
IGHV-Y4VK 12022-05-14watson_et_al:LEWES_EiJ_IGHV6-2FLEWES/EiJGAAGGGAAGCTTGAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCATAAAACTCTCCTGTGCTGCCTCTGGATTCACTTTTAGTGACGCCTGGATGGACTGGGTCCGCCAGTCTCCAGAGAAGGGACTTGAGTGGGTTGCTGAAATTAGAAACAAAGCTAGTAATTATGCAACATACTATGCTGAGTTTGTGAAAGGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACACCTTAAGAGCTGAAGACACCGGCATTTATTACTGTGAAGGGAAGCTTGAGGAGTCTGGAGGA...GGCTTGGTGCAACCTGGAGGATCCATAAAACTCTCCTGTGCTGCCTCTGGATTCACTTTT............AGTGACGCCTGGATGGACTGGGTCCGCCAGTCTCCAGAGAAGGGACTTGAGTGGGTTGCTGAAATTAGAAACAAAGCTAGTAATTATGCAACATACTATGCTGAGTTTGTGAAA...GGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACACCTTAAGAGCTGAAGACACCGGCATTTATTACTGT
IGHV-YJ7Z 12022-05-14watson_et_al:LEWES_EiJ_IGHV2-4FLEWES/EiJCAGGTGCAGCTGAAGGAGACAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCGTCTCAGGGTTCTCATTAACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGTAGTGATATGGAGTGATGGAAGCACAAACTATAATTCAGCTCTCAAATCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTCCAAACTGATGACACAGCCATGTACTACTGTGCCCAGGTGCAGCTGAAGGAGACAGGACCT...GGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGCACCGTCTCAGGGTTCTCATTA............ACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGTAGTGATATGGAGTGAT.........GGAAGCACAAACTATAATTCAGCTCTCAAA...TCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTCCAAACTGATGACACAGCCATGTACTACTGTGCC
IGHV-Z2MU 12022-05-14watson_et_al:LEWES_EiJ_IGHV6-1FLEWES/EiJGAAGTGAAGCTTGAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTTGCCTCTGGATTCACTTTCAGTAACTACTGGATGTACTGGGTCCGCCAGTCTCCAGAGAAGGGACTTGAGTGGGTTGCTGAAATTAGATTGAAATCTGATAATTATGCAACACATTATGCGGAGTCTGTGAAAGGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAGCTTAAGGGCTGAAGACACTGGAATTTATTACTGCGAAGTGAAGCTTGAGGAGTCTGGAGGA...GGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTTGCCTCTGGATTCACTTTC............AGTAACTACTGGATGTACTGGGTCCGCCAGTCTCCAGAGAAGGGACTTGAGTGGGTTGCTGAAATTAGATTGAAATCTGATAATTATGCAACACATTATGCGGAGTCTGTGAAA...GGGAGGTTCACCATCTCAAGAGATGATTCCAAAAGTAGTGTCTACCTGCAAATGAACAGCTTAAGGGCTGAAGACACTGGAATTTATTACTGC

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

History

History logs the times and reasons for the publication of each version of this germline set. Key changes are noted. For detailed changes, click on the link to the sequence.

William Lees
2022-05-14 15:32:52
Human germline set G00050 (LEWES/EiJ IGH) created

Human germline set G00050 (LEWES/EiJ IGH) created

William Lees
2022-05-14 15:40:21
Version 1 published

First release

Versions

All published versions of this germline set.

Set NameSpeciesSpecies subgroupLocusRelease VersionRelease Date
LEWES/EiJ IGHMouseLEWES/EiJIGH12022-05-14